ORFeome > slc15a2 ORF1 – XORFeome v1.0

slc15a2 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: slc15a2
Gene ID: 6077596
Gene Page ID: 486967
ORF Xenbase ID: 17296599

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC054967
Original XGC clone length: 2049

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11003
Well Location: G01

Sequences - 5ʹ (forward) EST

Accession: JZ839453
dbEST ID: 79657155
Trimmed Sequence: ATGTTCATTGTCGTCAACGAGTTCTGCGAACGATTCTCCTACTATGGAATGAAAGCTGTCCTCACCCTGTATTTCCTCAATTATCTGCACTGGGATGAAAACCTGTCAACAACCGTGTATCATGCCTTCAGCGGCCTCTGCTACTTCACCCCTCTTATTGGTGCCCCTATAGCTGACGCCTGGCTGGGGAAATTCAACACCATCTTTTATCTGTCAATCTTGTATGTCATTGGCCACATCATAAAGTCAGTGGGTGCCATCCCTACCGTGGGAAGTACCGAGGTGCACGTAGCGCTGTCCGTGATTGGCTTGATTGCCATTGCATTTGGTACGGGAGGCATTAAACCCTGTGTGGCTGCGTTTGGAGGGGACCAATTTGAGGAAGAGCATGCACAAGAACGCAGCAAATTCTTCTCCATCTTCTACTTGTCCATCAACGCTGGGAGTCTCATCTCCACCTTTGTCACCCCTGTACTTAGAGGGGACGTTCAGTGCTTCGGAGGGGACTGCTATGCGCTGGCATTTGGGGTTCCAGCTGCACTGATGTTTGTGGCTCTAATTGTGTTTGTTGCTGGCAGCGGTATGTACAAGAAATACCCACCCCAGGGCAACATCCTCGCCTCAGTGTTTGGCTGCATTGGGTTTGCACTGAAAAACCGCTGGAGACATCGATCCAAGCAGCACCCCAAGAGAGAGCACTGGTTGGACTGGGCCGATGAGAAGTATCAAAAAGACTCATCACAGAAATGAAAATGGTTGACAAAGGTGCTTTTTCCTCTACATTCCCCATGCCCCATGGTTTTGGGC
Full Trace Sequence: GGTTCTAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTTCATTGTCGTCAACGAGTTCTGCGAACGATTCTCCTACTATGGAATGAAAGCTGTCCTCACCCTGTATTTCCTCAATTATCTGCACTGGGATGAAAACCTGTCAACAACCGTGTATCATGCCTTCAGCGGCCTCTGCTACTTCACCCCTCTTATTGGTGCCCCTATAGCTGACGCCTGGCTGGGGAAATTCAACACCATCTTTTATCTGTCAATCTTGTATGTCATTGGCCACATCATAAAGTCAGTGGGTGCCATCCCTACCGTGGGAAGTACCGAGGTGCACGTAGCGCTGTCCGTGATTGGCTTGATTGCCATTGCATTTGGTACGGGAGGCATTAAACCCTGTGTGGCTGCGTTTGGAGGGGACCAATTTGAGGAAGAGCATGCACAAGAACGCAGCAAATTCTTCTCCATCTTCTACTTGTCCATCAACGCTGGGAGTCTCATCTCCACCTTTGTCACCCCTGTACTTAGAGGGGACGTTCAGTGCTTCGGAGGGGACTGCTATGCGCTGGCATTTGGGGTTCCAGCTGCACTGATGTTTGTGGCTCTAATTGTGTTTGTTGCTGGCAGCGGTATGTACAAGAAATACCCACCCCAGGGCAACATCCTCGCCTCAGTGTTTGGCTGCATTGGGTTTGCACTGAAAAACCGCTGGAGACATCGATCCAAGCAGCACCCCAAGAGAGAGCACTGGTTGGACTGGGCCGATGAGAAGTATCAAAAAGACTCATCACAGAAATGAAAATGGTTGACAAAGGTGCTTTTTCCTCTACATTCCCCATGCCCCATGGTTTTGGGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTTCATTGTCGTCAACGAG

Sequences - 3ʹ (reverse) EST

Accession: JZ839452
dbEST ID: 79657154
Trimmed Sequence: CATTTTGGTTTTCTTCTCCTCCATTGGGATTGCGTTCAGGTTGTCGTCCGGCAGCTGCTTCTTCTCCAATTCTTCATCATCCTTCAGGTCATCGGGATTAGCAGGGACATAGAAATAACCCATTATGGAGAAGATGATGCACACGGCAACCAGTAGAGCAGCAAACAGAATGAACTCCGCCCACTGCTCAAGGGTTCCGGCCTGTGCAACGATCAGCACAATGACATTTCCAATGGCGATGGTGAACAGCCACCCCGCCTGTAACACTGACTTCATACTGGTAGGAGCCTGAGAGTAAGAGAATTCCAGGCCAGTGACGGAGAACATGACTTCCCCGGCACTAAGGAGCACATACTGAGGGACCTGCCATGCCACATGGAAACTGTTGGCAGTGACATCTTCTGTCTTCTTCAGTTCAATGTTGCCGTCATTTCCCATTAGTAGTATGACTGTATAAGTAGCACCGAAGTTGAGTAACCCAAGGTCAAGTTCATATGTATTCAATTCAGTCAAGCAGCTTGCAGTTATCTTTCCTCTCTTCAGTGTCACATAATTGGACACGTCTCCTCTTCTGGCACTAACAGTGGAGTCACCAATAGTTACATTCGCCTCATCGCTGAGCATGTTAATAAACCTGACCATTGCTAATCCTTTGGCCTGGGTTTGGTTTTGTGATCTTCAATCAAGCTGCCATTTTAGGCTGTTCTCTTCACTAATACAAAAAAAAGCTGAAAGCCGCTTTTTCTCCTTCCAAAAAGAAACCTTGCCATTTC
Full Trace Sequence: AAAACCGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACATTTTGGTTTTCTTCTCCTCCATTGGGATTGCGTTCAGGTTGTCGTCCGGCAGCTGCTTCTTCTCCAATTCTTCATCATCCTTCAGGTCATCGGGATTAGCAGGGACATAGAAATAACCCATTATGGAGAAGATGATGCACACGGCAACCAGTAGAGCAGCAAACAGAATGAACTCCGCCCACTGCTCAAGGGTTCCGGCCTGTGCAACGATCAGCACAATGACATTTCCAATGGCGATGGTGAACAGCCACCCCGCCTGTAACACTGACTTCATACTGGTAGGAGCCTGAGAGTAAGAGAATTCCAGGCCAGTGACGGAGAACATGACTTCCCCGGCACTAAGGAGCACATACTGAGGGACCTGCCATGCCACATGGAAACTGTTGGCAGTGACATCTTCTGTCTTCTTCAGTTCAATGTTGCCGTCATTTCCCATTAGTAGTATGACTGTATAAGTAGCACCGAAGTTGAGTAACCCAAGGTCAAGTTCATATGTATTCAATTCAGTCAAGCAGCTTGCAGTTATCTTTCCTCTCTTCAGTGTCACATAATTGGACACGTCTCCTCTTCTGGCACTAACAGTGGAGTCACCAATAGTTACATTCGCCTCATCGCTGAGCATGTTAATAAACCTGACCATTGCTAATCCTTTGGCCTGGGTTTGGTTTTGTGATCTTCAATCAAGCTGCCATTTTAGGCTGTTCTCTTCACTAATACAAAAAAAAGCTGAAAGCCGCTTTTTCTCCTTCCAAAAAGAAACCTTGCCATTTC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACATTTTGGTTTTCTTCTCCTCCAT