ORFeome > slc17a5 ORF1 – XORFeome v1.0

slc17a5 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: slc17a5
Gene ID: 866507
Gene Page ID: 853686
ORF Xenbase ID: 17296647

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC124865
Original XGC clone length: 1491

Human orthology & disease relationships

NCBI Entrez ID: 26503
Ensembl gene IDs: ENSG00000119899
Directly associated (OMIM) disease MIM numbers: 269920,604369
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11088
Well Location: H03

Sequences - 5ʹ (forward) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: TCGGGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGGAGACGGGAGAGCGACTCGGTTGACCGGAGCCCATTGCGGGCATATCCTGGGGTGTTTGAGTATAACATCCAGAGGTCGCCTCCAGCAACAACGGCTGCTTGTTGTGCATCCCTATGACTCCAGAGATTGTGGTACTACCACGCTACTTTGTATTTTCTCGACTGTGTTCTTGGGAATTTTAGCGAGAATGCCTTGCCAGGCAGCCACCGTCTCCATGTACCACTAAATAATAAAAATACGTTTTTGTATAGCGCTTCTCTAACACTACGAATCCTAGTTCCTACGAACAATTGTGGGCATCTTTAATGGGGCGGGATTAAGACCTAACAAACAGCATTTTTGGCTCTTTTTTCAATGGACATATTCTCACTCAGAACACTGGTGCGAACCGTTTTGCGAACAATTGACGGGAAACAGCTATCCTGAATGGGGAAACAGGGTCCTCGTTTGCTCTCGTTTGACTAATCCTCATGGGACGCGGAAAAAGTGGGCAGGGACGACCTGCTCCAAATAACTACTACCCGAAAACCTTGATAAAGTTGAGTAAGAAAAAGCACGCTTTTCCTTTGTGAGTATAGAAGGTACAGGACCTCCCTTTTATGAAAGGAGGGAAAAAAGGCACAGCCTTTGTTAAAAAGAGGGTGATTGATTTTGAAAAAGGGTGTAAACATTCCCCCATGTTCAGGGGATAAGTTTTTCAATATTTGTGAAACAGGGAGGGAAAGGCTTCCCGAAATTTGGCTGCGTGACTTTGGGGGGACTTCGGAAGCTATGACACTCTTTTTTCTTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGGAGACGGGAGAGCGA

Sequences - 3ʹ (reverse) EST

Accession: JZ838086
dbEST ID: 79655788
Trimmed Sequence: ATTGTCCTCTTCTATATTGTGGGAAACGGCCCAGTCTTGTACATTACCACTTGCAAATATTATAAAAAATATGGCTCCAAAAAAATTAATAGCAGCTGCGATATAGAACACAATTTGCCATTGTTCCACGGTATTATCATGAGTAAGTTCTTTGGCAATAATAGGACCGACCATTCCAGGAATTGTAGCAAATGTGTTTGTGATTCCAAGTAATAACCCAGCAAAAGAGGGTGCTATGTCTAGATGGTTTATGCCATATCCTGCTACACTAAATCCTCCCAGTGTAGTTGACAAAGTAAGAAATACAACAGCCAGTGTATAATTACAACCTGTATACCCAGCCGCTAACAGAAATATAGCTGGCCCGAGCATTCCTAGTGTGTTGAAGATTTTTCGAACAACTTTGGTTGAAAAGTTTAGCTTCTCTCTCATATAGTCAGCTAGAACACCTGCCAAGATCATAAATACCCAGCATCCCAAATAAGGCAGAGCAGATAGGAATCCATTCTCCTGAGCATTAGAGCGTAAGATCTCCTTCATATATGTGGGTAAGAGAGTCAACAGTGTGTAAAACGTCCAGTTGTAAGAGAAATGTGCTACTATNATGGGCCATAAAGGCAATGACTTCAGCATTGCACAGCAAGGAACAGACTTCTAATGAGAAAGTTTGATCTTGAAGAGCAAAAAGTTATGTATTCCTTTTTCTTAATCACTAATACCTTTTTGGAAAAAAATGGGGGGTGTCCACTCCACAAAAAAAAACACACAAA
Full Trace Sequence: GAGGAAAATGCTTATGACCATGTAATACGACTCACTATANGGGGATATCNAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATTGTCCTCTTCTATATTGTGGGAAACGGCCCAGTCTTGTACATTACCACTTGCAAATATTATAAAAAATATGGCTCCAAAAAAATTAATAGCAGCTGCGATATAGAACACAATTTGCCATTGTTCCACGGTATTATCATGAGTAAGTTCTTTGGCAATAATAGGACCGACCATTCCAGGAATTGTAGCAAATGTGTTTGTGATTCCAAGTAATAACCCAGCAAAAGAGGGTGCTATGTCTAGATGGTTTATGCCATATCCTGCTACACTAAATCCTCCCAGTGTAGTTGACAAAGTAAGAAATACAACAGCCAGTGTATAATTACAACCTGTATACCCAGCCGCTAACAGAAATATAGCTGGCCCGAGCATTCCTAGTGTGTTGAAGATTTTTCGAACAACTTTGGTTGAAAAGTTTAGCTTCTCTCTCATATAGTCAGCTAGAACACCTGCCAAGATCATAAATACCCAGCATCCCAAATAAGGCAGAGCAGATAGGAATCCATTCTCCTGAGCATTAGAGCGTAAGATCTCCTTCATATATGTGGGTAAGAGAGTCAACAGTGTGTAAAACGTCCAGTTGTAAGAGAAATGTGCTACTATNATGGGCCATAAAGGCAATGACTTCAGCATTGCACAGCAAGGAACAGACTTCTAATGAGAAAGTTTGATCTTGAAGAGCAAAAAGTTATGTATTCCTTTTTCTTAATCACTAATACCTTTTTGGAAAAAAATGGGGGGTGTCCACTCCACAAAAAAAAACACACAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATTGTCCTCTTCTATATTGTGGG