ORFeome > slc18a2 ORF1 – XORFeome v1.0

slc18a2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: slc18a2
Gene ID: 6254956
Gene Page ID: 940057
ORF Xenbase ID: 17296659

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC059350
Original XGC clone length: 1428

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11020
Well Location: C08

Sequences - 5ʹ (forward) EST

Accession: JZ824678
dbEST ID: 79642380
Trimmed Sequence: ATGACAAGATGTTCCCCGTGTCAGTGTTTGAAGGGAACATGCGAGTCCCGGAGGCTGATCCTGTTTGTGATTGCAGTGGCCATGTTTGTGGATTGTATTCTGTTCTCAGTTGTCGCTCCAATCGCCCCAGCTTTGCTTTATGACACAGAGTATGGGAAAGGAAACACAACTATAACCATTCACGACTCCGATTTTTCCTCTGTTATTCTTTCAAATCTTTCGATCTTTGAAAACTCAACAAAAGCACTGTACAATGACCAGATGGTTAATAGTACAGCGAGTGGCGGAAATCAAACGGAGTGCTACGAGGGGAAGGACTACTTAAATGAAGTGAATGTGAGAGTGGGTCTTCTCCTTGCTATTAAAGCCATACTGCAGATTCTGATAAACCCCATAGTGGGTAAACTCATTAACAGAACTGGATATGATGCCCCATTGTTTTATGGCTCTATCATTATGTTTATCTCCACTATCATGTTTGCCTTTGCCGATTCATATGCCTTTCTTTGTGTGGCCAGGGGCTGCAGGGAATCGGATCATCCTTCACTATAGTACCAGCTATGGGCATGCTGGCACATTTGTTTCCTGATGATGCTGAAAGAGGCAAAGTCATGGGACTAGCCATGAGTGGTATTGCCACTGGTGTGCTTGTGGCGCCTCCCTTTGGGTCTGCCATGTATGAGTTTGNTTGGAAAGTCTTCTCCCATTATTGGTATAGGCAGCCTTGCTCTTCTATATGGAGCCCTAACAGCTTTGTTTACTCTAACCTTTGAAATTTTCCCCCGTAACTGTTCCCCCACAACCCTTCGGGGACTTCCCGTGAGACCTTCCTTTTTTGGTGGGCG
Full Trace Sequence: AATGAATTTTATTTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACAAGATGTTCCCCGTGTCAGTGTTTGAAGGGAACATGCGAGTCCCGGAGGCTGATCCTGTTTGTGATTGCAGTGGCCATGTTTGTGGATTGTATTCTGTTCTCAGTTGTCGCTCCAATCGCCCCAGCTTTGCTTTATGACACAGAGTATGGGAAAGGAAACACAACTATAACCATTCACGACTCCGATTTTTCCTCTGTTATTCTTTCAAATCTTTCGATCTTTGAAAACTCAACAAAAGCACTGTACAATGACCAGATGGTTAATAGTACAGCGAGTGGCGGAAATCAAACGGAGTGCTACGAGGGGAAGGACTACTTAAATGAAGTGAATGTGAGAGTGGGTCTTCTCCTTGCTATTAAAGCCATACTGCAGATTCTGATAAACCCCATAGTGGGTAAACTCATTAACAGAACTGGATATGATGCCCCATTGTTTTATGGCTCTATCATTATGTTTATCTCCACTATCATGTTTGCCTTTGCCGATTCATATGCCTTTCTTTGTGTGGCCAGGGGCTGCAGGGAATCGGATCATCCTTCACTATAGTACCAGCTATGGGCATGCTGGCACATTTGTTTCCTGATGATGCTGAAAGAGGCAAAGTCATGGGACTAGCCATGAGTGGTATTGCCACTGGTGTGCTTGTGGCGCCTCCCTTTGGGTCTGCCATGTATGAGTTTGNTTGGAAAGTCTTCTCCCATTATTGGTATAGGCAGCCTTGCTCTTCTATATGGAGCCCTAACAGCTTTGTTTACTCTAACCTTTGAAATTTTCCCCCGTAACTGTTCCCCCACAACCCTTCGGGGACTTCCCGTGAGACCTTCCTTTTTTGGTGGGCG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACAAGATGTTCCCCGT

Sequences - 3ʹ (reverse) EST

Accession: JZ830030
dbEST ID: 79647732
Trimmed Sequence: TGAGGCTTGTATCCCTTCTTGGCTTAGTAGAGGCTTTGTCTCCTCTTTTCCAGGTGGGTTGCGCACTAGAATGAAGAGAGGGGCAAATGCAATGTTTATTATACCTAATATAATCATTAACCATTTGAACCCAACAGCTTTGGCGATGGCTCCTCCACATGATGGACCCAGTGCATAACCAATACAGAGGGCGATATCAGAGATGGCGTAGATGCCCCCATAGTTTGAAGTGTGACGTAAATCTACCAGTTGTGCCATGAGTGGCATTATTGATGTTTCCATCAACCCAAAGCCGATTCCCAGTGCAGCACTAGGTCCAATGAGTCCATAAATATTTAAAGCTAAAGGCATACAAATGACGCTGATCCCTAGGATGATCATTCCAAACAAAATGCATAGATACCTTCCGATTTTTTGTGCAAGGCTAGCAAATCCATTCAGACAAATGAAATATACAACCATACATGGTAGAAAAGCCAGACCAAGTTGATAGCGGGGGGCACACATGGCTTCCATCATTCTAATTGTTAAAGTTGGCTCCAGCATGCCAAATGTAAGATTACCAATACAGAGACCCACTGCTGCCACCAAAATGTAACGATCCATGAGAAGATCCCCTGAAGGGTGTTGCGGGGACAGCTACTGGGGGAAATTTCCATAGGTCGAAGTATACCAAAGCTGTAGTGCTTCCTATTTGAAGAACCCAAGGCTGCTATTACCCTTTAAATGGGAGAAAGACTTTTCCACCAAACTCCTAAACTGGGGAAAAAACCAAGGGGG
Full Trace Sequence: ACGGGAAACAGCTATGACCATGTAATACGACTCACTATANGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGAGGCTTGTATCCCTTCTTGGCTTAGTAGAGGCTTTGTCTCCTCTTTTCCAGGTGGGTTGCGCACTAGAATGAAGAGAGGGGCAAATGCAATGTTTATTATACCTAATATAATCATTAACCATTTGAACCCAACAGCTTTGGCGATGGCTCCTCCACATGATGGACCCAGTGCATAACCAATACAGAGGGCGATATCAGAGATGGCGTAGATGCCCCCATAGTTTGAAGTGTGACGTAAATCTACCAGTTGTGCCATGAGTGGCATTATTGATGTTTCCATCAACCCAAAGCCGATTCCCAGTGCAGCACTAGGTCCAATGAGTCCATAAATATTTAAAGCTAAAGGCATACAAATGACGCTGATCCCTAGGATGATCATTCCAAACAAAATGCATAGATACCTTCCGATTTTTTGTGCAAGGCTAGCAAATCCATTCAGACAAATGAAATATACAACCATACATGGTAGAAAAGCCAGACCAAGTTGATAGCGGGGGGCACACATGGCTTCCATCATTCTAATTGTTAAAGTTGGCTCCAGCATGCCAAATGTAAGATTACCAATACAGAGACCCACTGCTGCCACCAAAATGTAACGATCCATGAGAAGATCCCCTGAAGGGTGTTGCGGGGACAGCTACTGGGGGAAATTTCCATAGGTCGAAGTATACCAAAGCTGTAGTGCTTCCTATTTGAAGAACCCAAGGCTGCTATTACCCTTTAAATGGGAGAAAGACTTTTCCACCAAACTCCTAAACTGGGGAAAAAACCAAGGGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGAGGCTTGTATCCCTTCTT