ORFeome > slc19a3 ORF2 – XORFeome v1.0

slc19a3 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: slc19a3
Gene ID: 6251629
Gene Page ID: 983223
ORF Xenbase ID: 17296671

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC128930
Original XGC clone length: 942

Human orthology & disease relationships

NCBI Entrez ID: 80704
Ensembl gene IDs: ENSG00000135917
Directly associated (OMIM) disease MIM numbers: 607483
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11086
Well Location: D06

Sequences - 5ʹ (forward) EST

Accession: JZ837868
dbEST ID: 79655570
Trimmed Sequence: ATGGCAGGGTGCTGCAAGCAATACACCGATGGCTGGAAATATCCAACAATTCTTCTCTGCCTCTTTGGATTTTTTGTGAATTTGAGAGCTGTGGAACCATTCTTTGCTGCATATCTTATAGGACCACATCACAATCTGACATCTGAACAGGTGTCAGCCTCTGTGCTTCCAGTGTGGACTTACAGTCACCTGGCATTGTTGCTTCCAGTATTCCTGCTAACAGATTACCTGCGTTACAAGCCAGTCATAATCCTGCAAGGCCTCGGAATCATCATCTCGTTGCTTTTATCGTTGCTAACCCATGGTGTTCCAGCAATGCAAGTGATGGAGTTTTTCTATGGCATATTTACTGCCTGTGATCCGGCATATTACGCCTACATCTACAGTGTGGTTGACATTGCACATTACCAGAAGGTAACTGGTTACTGCCGGAGCATAACACTGGTTGGTGTTGCCCTTGGTGCAGTGATTGGACAATTGTTAGTCTCCTTGGCAGGGATCTCATTAGTCTATCTCAATGTAATCTCATTGACATCAACCTCGATGGCTTTTTTGTGCTCTTTGTTTCTTTCCTTCCCGGTAAGACTATGTTTGTTCACAGGAAAGATGGCGTGGGGAGGCTACAAATATATTAATCTAAAAAAATGGAATCTGCTCTATTCCCAACCAAATACCAAATTGTAACTAATTACAGAAAACTGAAAAAAAAGGGCGGTTAATGAAGTGCCCCCATGTTACTAATCTCCCCCCCGCGGTGAAGGAAAGAGGGGAAAAGGGTATAACTCCTCTCAAAGGCGAAACCCTTTGTACCAGGATCCCACTTGGGG
Full Trace Sequence: TCGAGGGCCCAATAATAGATTTTANTTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCAGGGTGCTGCAAGCAATACACCGATGGCTGGAAATATCCAACAATTCTTCTCTGCCTCTTTGGATTTTTTGTGAATTTGAGAGCTGTGGAACCATTCTTTGCTGCATATCTTATAGGACCACATCACAATCTGACATCTGAACAGGTGTCAGCCTCTGTGCTTCCAGTGTGGACTTACAGTCACCTGGCATTGTTGCTTCCAGTATTCCTGCTAACAGATTACCTGCGTTACAAGCCAGTCATAATCCTGCAAGGCCTCGGAATCATCATCTCGTTGCTTTTATCGTTGCTAACCCATGGTGTTCCAGCAATGCAAGTGATGGAGTTTTTCTATGGCATATTTACTGCCTGTGATCCGGCATATTACGCCTACATCTACAGTGTGGTTGACATTGCACATTACCAGAAGGTAACTGGTTACTGCCGGAGCATAACACTGGTTGGTGTTGCCCTTGGTGCAGTGATTGGACAATTGTTAGTCTCCTTGGCAGGGATCTCATTAGTCTATCTCAATGTAATCTCATTGACATCAACCTCGATGGCTTTTTTGTGCTCTTTGTTTCTTTCCTTCCCGGTAAGACTATGTTTGTTCACAGGAAAGATGGCGTGGGGAGGCTACAAATATATTAATCTAAAAAAATGGAATCTGCTCTATTCCCAACCAAATACCAAATTGTAACTAATTACAGAAAACTGAAAAAAAAGGGCGGTTAATGAAGTGCCCCCATGTTACTAATCTCCCCCCCGCGGTGAAGGAAAGAGGGGAAAAGGGTATAACTCCTCTCAAAGGCGAAACCCTTTGTACCAGGATCCCACTTGGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAGGGTGCTGCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ837867
dbEST ID: 79655569
Trimmed Sequence: ACACAAAATGCACTCACTAAGAAATGTGGATATGGCCTGAGCTCCGCCATTGTACAAAGCAAAATTCTGAGAAGGTTCTATGTGTTCCCATAGAAGCTGCACATAATTTATAATTTGACTATATCCGGCTGTTGCAAATGCCCACCACAAGGACCAGTACAAGATTTGCTTAGAGGAGTAACAGTCTTTCATTTCTTTACCCAGGCGCCATAGTAACTGGAGGCATTGATTACTGCCTTTGTTCTCAGTTTCTGTAATAGTCACACTCTGTATTTGCTCTGAATGAGGAGATTCCATCTCTTTGGATAATATATTTGTAGTGTCTCCAGCCATCTTCCTGTGAACAAACATAGTCCTACTGGGTAAGGGAAGAAACAAAGAGCACAAAAAAGCCATCGAGGTTGATGTCAATGAGATTACATTGAGATAGACTAATGAGATCCCTGCCAAGGAGACTAACAATTGTCCAATCACTGCACCAAGGGCAACACCAACCAGTGTTATGCTCCGGCAGTAACCAGTTACCTTCTGGTAATGTGCAATGTCCACCACACTGTAGAATGTAGCGTAATATGCCGGATCACAGGCAGTAAATATGCCATAGAAAAACTCCATCACTTTCATTGCTGGAACACCAGGGGGTGAGCAACCATAAAACAACAAGATGATGATTCCGACGCCGTGGGGGAATATTACTGGGCTGTAACGCAGGTAACCTGGTTACAGGAAGACGGAAGCCAGCATGCCGGTGACTGTGGGTTCACCTGGAAACAACAAAGCTGGACCCTTTTAAAATGTCAAATTGTGATGGGGTGGGGGAGAAATGCAACAAAAAATGGTTCCGCGGGCGCGGGATGCGGAAAATGCAAAAAAAGCCAAAAAAAATATTGGAAATTCCGGCCGACCGTGGGGTGCTGGAGACACCCTCCAAGAAACCAACCTTATTTTGCAAATTTTCATTTAAAAAAAAGCTTACGTTAGCAATTGGTTTGGGAAGAAACAGGGGGGGGGAGAAAAAAAAAAAAAAAAAATAAAGAAAAAATCCAAATATAAAAACATGCCCCATCATTTTTACAACCACTCGCTTAGAACTGGAGCTAGGGAGTTCGAGGTCTACTGGGGGAGNGGGGAGAGAGGGAAGGAGNAGGAAGAGAGAAAGAGAAAGGAGAGGGAGGGGCGGAGGAGNAGAGTTAGTTNGN
Full Trace Sequence: CGGGCAGGTAACTAGCTATGACCATGTAATACGACTCACTATANGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAACACAAAATGCACTCACTAAGAAATGTGGATATGGCCTGAGCTCCGCCATTGTACAAAGCAAAATTCTGAGAAGGTTCTATGTGTTCCCATAGAAGCTGCACATAATTTATAATTTGACTATATCCGGCTGTTGCAAATGCCCACCACAAGGACCAGTACAAGATTTGCTTAGAGGAGTAACAGTCTTTCATTTCTTTACCCAGGCGCCATAGTAACTGGAGGCATTGATTACTGCCTTTGTTCTCAGTTTCTGTAATAGTCACACTCTGTATTTGCTCTGAATGAGGAGATTCCATCTCTTTGGATAATATATTTGTAGTGTCTCCAGCCATCTTCCTGTGAACAAACATAGTCCTACTGGGTAAGGGAAGAAACAAAGAGCACAAAAAAGCCATCGAGGTTGATGTCAATGAGATTACATTGAGATAGACTAATGAGATCCCTGCCAAGGAGACTAACAATTGTCCAATCACTGCACCAAGGGCAACACCAACCAGTGTTATGCTCCGGCAGTAACCAGTTACCTTCTGGTAATGTGCAATGTCCACCACACTGTAGAATGTAGCGTAATATGCCGGATCACAGGCAGTAAATATGCCATAGAAAAACTCCATCACTTTCATTGCTGGAACACCAGGGGGTGAGCAACCATAAAACAACAAGATGATGATTCCGACGCCGTGGGGGAATATTACTGGGCTGTAACGCAGGTAACCTGGTTACAGGAAGACGGAAGCCAGCATGCCGGTGACTGTGGGTTCACCTGGAAACAACAAAGCTGGACCCTTTTAAAATGTCAAATTGTGATGGGGTGGGGGAGAAATGCAACAAAAAATGGTTCCGCGGGCGCGGGATGCGGAAAATGCAAAAAAAGCCAAAAAAAATATTGGAAATTCCGGCCGACCGTGGGGTGCTGGAGACACCCTCCAAGAAACCAACCTTATTTTGCAAATTTTCATTTAAAAAAAAGCTTACGTTAGCAATTGGTTTGGGAAGAAACAGGGGGGGGGAGAAAAAAAAAAAAAAAAAATAAAGAAAAAATCCAAATATAAAAACATGCCCCATCATTTTTACAACCACTCGCTTAGAACTGGAGCTAGGGAGTTCGAGGTCTACTGGGGGAGNGGGGAGAGAGGGAAGGAGNAGGAAGAGAGAAAGAGAAAGGAGAGGGAGGGGCGGAGGAGNAGAGTTAGTTNGN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACACAAAATGCACTCACTAAGAAA