ORFeome > slc1a3 ORF1 – XORFeome v1.0

slc1a3 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: slc1a3
Gene ID: 975317
Gene Page ID: 975312
ORF Xenbase ID: 17296677

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC060347
Original XGC clone length: 1629

Human orthology & disease relationships

NCBI Entrez ID: 6507
Ensembl gene IDs: ENSG00000079215
Directly associated (OMIM) disease MIM numbers: 612656
Indirectly associated (Lage, et al.) disease MIM numbers: 101900,248600,268300,601003,609909

Library Location

Plate ID: GDExl11023
Well Location: G07

Sequences - 5ʹ (forward) EST

Accession: JZ824928
dbEST ID: 79642630
Trimmed Sequence: ATGACCAAAAGCAACGGGGAAGATCCACGGTCAGGGAACAGGATGGAGCGCTTCCAGGAAGGGGTTCGCCAGCGTTCTCTGATGGCCAAAAAAAAGATGCAGAACATAACAAAAGATGATGTGAAGAGTTTCTTCAAGCGCAATGGCTTTGTCCTTTTTACCGTCTTCGCTGTCATTATTGGTATCATCCTGGGATTTTCTGTCCGAAAGTATCACATGACGTTCAGAGAGATCAAGTACTTCTCCTTCCCAGGGGAGCTTCTCATGAGAATGCTGCAGATGCTGGTCCTCCCTCTGATTGTATCCAGCTTAGTGACAGGAATGTCTGCTCTCGACAGTAAGGCATCGGGAAAGATGGGAATACGAGCCGTGGTATATTACATGACAACAACGGTGCTTGCTGTTTTCATCGGTATTATTATTGTCATAATAATCCACCCAGGAAAGGGCAGCAAGGAGAAAATGCACAGAGAAGGAAAAATTGAGCAAGTAACTGCAGCTGATGCTTTTCTGGATTTAATAAGAAATATGTTCCCGCCTAACATGGTAGAAGCCTGCTTTAAACAGTTCAAGACAAACTATGAGAAGAAACTGTTTCGAGTCCCCATTCCAGCCAATGAATCCCTTCTGTCTTCAGTAGCCAATAATGTATCCGAGGCCATGGNAACATTGGTTAAGATGAAGGAAGAGATGATANCCGTTTCCAGACAGTGAATGGAGTCATGCCTTTGGAACTGTGGGTTTCTCATGTCCTTTTGGGCTGGTCATGGAACATGAAGAACAGGGGAAAGCTTTTAGGACTTTTTTGATTCTCAC
Full Trace Sequence: ATTTTTATTTTTCGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACCAAAAGCAACGGGGAAGATCCACGGTCAGGGAACAGGATGGAGCGCTTCCAGGAAGGGGTTCGCCAGCGTTCTCTGATGGCCAAAAAAAAGATGCAGAACATAACAAAAGATGATGTGAAGAGTTTCTTCAAGCGCAATGGCTTTGTCCTTTTTACCGTCTTCGCTGTCATTATTGGTATCATCCTGGGATTTTCTGTCCGAAAGTATCACATGACGTTCAGAGAGATCAAGTACTTCTCCTTCCCAGGGGAGCTTCTCATGAGAATGCTGCAGATGCTGGTCCTCCCTCTGATTGTATCCAGCTTAGTGACAGGAATGTCTGCTCTCGACAGTAAGGCATCGGGAAAGATGGGAATACGAGCCGTGGTATATTACATGACAACAACGGTGCTTGCTGTTTTCATCGGTATTATTATTGTCATAATAATCCACCCAGGAAAGGGCAGCAAGGAGAAAATGCACAGAGAAGGAAAAATTGAGCAAGTAACTGCAGCTGATGCTTTTCTGGATTTAATAAGAAATATGTTCCCGCCTAACATGGTAGAAGCCTGCTTTAAACAGTTCAAGACAAACTATGAGAAGAAACTGTTTCGAGTCCCCATTCCAGCCAATGAATCCCTTCTGTCTTCAGTAGCCAATAATGTATCCGAGGCCATGGNAACATTGGTTAAGATGAAGGAAGAGATGATANCCGTTTCCAGACAGTGAATGGAGTCATGCCTTTGGAACTGTGGGTTTCTCATGTCCTTTTGGGCTGGTCATGGAACATGAAGAACAGGGGAAAGCTTTTAGGACTTTTTTGATTCTCAC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACCAAAAGCAACGGGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ830296
dbEST ID: 79647998
Trimmed Sequence: CATTTTCGTTTCGCTGTCTAAGGGTTTCTCGCTTTCATTTTCCTGGGAGATCAGCTGGTATGGTTTCTTCATTTCATTCTCCTCAATGACTGAGTTGCCCATCTCAGCGTCGCCTCCCTTGAGCTCGTGCCTAGACAAATGTTCTACGATGCCTGCACCCAGAGAGTCTCCAAGTACATTGGTTGTGGTACGAAGACGGTCCAAAAACCAGTCTACGGCAATAATCAACGTAATGTCTTCTGTTGGAAGCCCCACTGATGTCAAAACAATAACCATGGTGACCAAACCAGCTTGAGGGATTCCCGCTGCTCCAATGCTGGCGGCTGTAGCTGTGATACTGATTGTAATAATCTGCCCAAAATTCAGATCGTAATTGTTGACTTGAGCGATAAAAATGGCAGCCAGGGCTTCATAGAGGGCAGTGCCATCCATATTGATTGTGGCTCCTACTGGTAGCACAAATCTTGTAACTCTTTTGTCCACGTGATTGTTCTCTTCCAGGCATTTAAATGTAACTGGTAATGTAGCAGAACTCGAGGAGGTTCCCAGAGCGGTGATTAAGGCTTGGATCAATCCACCAATGAAAACCCATGGGTTTTTTCGAGTTACCAAAAGTAGAGGAGCGGTAAAACGAACACAGCATGGATAACCAGTCCTATAATAACCCGTAAGGGTGTACATTCCCAAGCTGCCCACCCAACTACCCCCCATATCTTTCCATCTCGGGCAATCCTTTCCCGCCAATCCAAAAAGAAAGAAAAACCAA
Full Trace Sequence: TGACAGGCAGCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACATTTTCGTTTCGCTGTCTAAGGGTTTCTCGCTTTCATTTTCCTGGGAGATCAGCTGGTATGGTTTCTTCATTTCATTCTCCTCAATGACTGAGTTGCCCATCTCAGCGTCGCCTCCCTTGAGCTCGTGCCTAGACAAATGTTCTACGATGCCTGCACCCAGAGAGTCTCCAAGTACATTGGTTGTGGTACGAAGACGGTCCAAAAACCAGTCTACGGCAATAATCAACGTAATGTCTTCTGTTGGAAGCCCCACTGATGTCAAAACAATAACCATGGTGACCAAACCAGCTTGAGGGATTCCCGCTGCTCCAATGCTGGCGGCTGTAGCTGTGATACTGATTGTAATAATCTGCCCAAAATTCAGATCGTAATTGTTGACTTGAGCGATAAAAATGGCAGCCAGGGCTTCATAGAGGGCAGTGCCATCCATATTGATTGTGGCTCCTACTGGTAGCACAAATCTTGTAACTCTTTTGTCCACGTGATTGTTCTCTTCCAGGCATTTAAATGTAACTGGTAATGTAGCAGAACTCGAGGAGGTTCCCAGAGCGGTGATTAAGGCTTGGATCAATCCACCAATGAAAACCCATGGGTTTTTTCGAGTTACCAAAAGTAGAGGAGCGGTAAAACGAACACAGCATGGATAACCAGTCCTATAATAACCCGTAAGGGTGTACATTCCCAAGCTGCCCACCCAACTACCCCCCATATCTTTCCATCTCGGGCAATCCTTTCCCGCCAATCCAAAAAGAAAGAAAAACCAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACATTTTCGTTTCGCTGTCTAAGG