ORFeome > slc1a4 ORF1 – XORFeome v1.0

slc1a4 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: slc1a4
Gene ID: 6251435
Gene Page ID: 980498
ORF Xenbase ID: 17296683

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC127425
Original XGC clone length: 1584

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11084
Well Location: E01

Sequences - 5ʹ (forward) EST

Accession: JZ837421
dbEST ID: 79655123
Trimmed Sequence: ATGAAGGACGCCGAGTGTAATGGCACCTCCTCACCCGGGGATCACCCCGTGCCTCCCGGCCTGCATCGCCCTGGAGAATCCTCTCCCTCCCCTGGATGCGGCCCCCGGTGCTGCCGGTTCCTACGGGGGAATGTGCTGGTGCTGCTGACGGTGACGGGGGTGATTTTGGGCGCAGGGCTGGGGATGGCAGTGAGGCCGCTGAATATGTCCAAAGCTCAGATCGCCTCTTTCTCCTTCCCGGGGGAACTGCTGCTTCGCCTCCTCAAGATGATCATCCTGCCGCTGGTGGTCTGTAGTCTGGTGTCCGGGGCCGCTTCCCTCCAGCCCTCTGCCTTGGGCAAGCTCGGGGGATGGGCCATGCTCTTCTTCCTCGTCACCACGCTGCTCGCTTCAGGGCTAGGAGTCTGTCTGGCACTGCTCATACGGCCGGGGGTGGGAGCCGAGATGGAATCGGGAAAAGGAGATGGAGTCCCAGACGGCAAGGATGTGCTGGACTCGTTCCTGGATCTGGTCCGAGATATTTTCCCATCACACTTGGTGTCTGCTGCTTTTCATTCTTATGCCCCTATTTACCAACTTGAACTTGTACATTCAAATGTAAAGGGAGACATTAACAGCAGGATGGGTTTAGGCTCCCCTAAGCCAGCAGGTGGAAGGTTGGGGTATATTTGAACTTGGATGGACTTTTGCCGGGGTTGTTTGGAAATTTCGCTTAAGGGAGTGTGGAAGCCGGGGGGGGGGAAGGGTTTTATTTCATTTTTTCTACTTTCTTAAGAGTAAAACAACACATCCCTCCGGGCTCACCTTTCCCATCGGTCCTGTTGGGGCGC
Full Trace Sequence: CGTGGGCCCAAATAATTGATTTTANTTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAAGGACGCCGAGTGTAATGGCACCTCCTCACCCGGGGATCACCCCGTGCCTCCCGGCCTGCATCGCCCTGGAGAATCCTCTCCCTCCCCTGGATGCGGCCCCCGGTGCTGCCGGTTCCTACGGGGGAATGTGCTGGTGCTGCTGACGGTGACGGGGGTGATTTTGGGCGCAGGGCTGGGGATGGCAGTGAGGCCGCTGAATATGTCCAAAGCTCAGATCGCCTCTTTCTCCTTCCCGGGGGAACTGCTGCTTCGCCTCCTCAAGATGATCATCCTGCCGCTGGTGGTCTGTAGTCTGGTGTCCGGGGCCGCTTCCCTCCAGCCCTCTGCCTTGGGCAAGCTCGGGGGATGGGCCATGCTCTTCTTCCTCGTCACCACGCTGCTCGCTTCAGGGCTAGGAGTCTGTCTGGCACTGCTCATACGGCCGGGGGTGGGAGCCGAGATGGAATCGGGAAAAGGAGATGGAGTCCCAGACGGCAAGGATGTGCTGGACTCGTTCCTGGATCTGGTCCGAGATATTTTCCCATCACACTTGGTGTCTGCTGCTTTTCATTCTTATGCCCCTATTTACCAACTTGAACTTGTACATTCAAATGTAAAGGGAGACATTAACAGCAGGATGGGTTTAGGCTCCCCTAAGCCAGCAGGTGGAAGGTTGGGGTATATTTGAACTTGGATGGACTTTTGCCGGGGTTGTTTGGAAATTTCGCTTAAGGGAGTGTGGAAGCCGGGGGGGGGGAAGGGTTTTATTTCATTTTTTCTACTTTCTTAAGAGTAAAACAACACATCCCTCCGGGCTCACCTTTCCCATCGGTCCTGTTGGGGCGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAGGACGCCGAGTGTAA

Sequences - 3ʹ (reverse) EST

Accession: JZ837420
dbEST ID: 79655122
Trimmed Sequence: CATGGTAGACTCCTTTTCCATGGCACTTGCTCCATCACTGTTTAATCGTGCATGCGCTTTTAGGAGTGGGTCACCTTCAAAATGGTCTCCAGGAATTTCAACTTGTACTGCTGCCAGCTCTGCGCCATCGTTACTTGAAGCTGTCCGGTCGCTGTATACCTGCAGAAGCCCGGCACCAAAGGCATCACCTTCTACATTTAGTATAGTGCATGTGCGGTCAACCAGCCAGTCCACAGCAAGGATAAGTGAAATGTCATTTGTCGGAAGCCCCACAGCTTCTAATATTATAGCAAGAGTCAGAACGCCCCCGGCAGGAATACCAGCTGCTCCCACACTGGAAGCTGTGGCTGTTACAAGAATGGTAACGATTTGAATGAAGTCAAGGGAGACGTTGTTAAGTTGGGCAATAAATACGGCCGCTACACACTGAAAAAGAGCAGCACCATCCATATTCACTGTGGCTCCTATTGGAAGGATGAACCGACTGATCTGTTTGGAAACACCATTCTTTTCCTCTACACATTTCATCATTAATGGAAGTGTGGCCGAGCTGGAAAAAGTTCCAAATGCTGTTGCCAGTGCACTCACAATTCCCCACAGGAAGCGGTATGGGTTCTTCCGAGTAAATGCAAAAATAAATTAATGGGGAAAACCAGCAATTCCCTGGTATCAAATGCCCAACAATGCCACAAGAAAATGTACTTCCCCCAAAACTGGTTGAAAAAACCTGGAACAAAATCCTTTCCCCTCTCCCACACATTCCTTC
Full Trace Sequence: AAAACGTCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACATGGTAGACTCCTTTTCCATGGCACTTGCTCCATCACTGTTTAATCGTGCATGCGCTTTTAGGAGTGGGTCACCTTCAAAATGGTCTCCAGGAATTTCAACTTGTACTGCTGCCAGCTCTGCGCCATCGTTACTTGAAGCTGTCCGGTCGCTGTATACCTGCAGAAGCCCGGCACCAAAGGCATCACCTTCTACATTTAGTATAGTGCATGTGCGGTCAACCAGCCAGTCCACAGCAAGGATAAGTGAAATGTCATTTGTCGGAAGCCCCACAGCTTCTAATATTATAGCAAGAGTCAGAACGCCCCCGGCAGGAATACCAGCTGCTCCCACACTGGAAGCTGTGGCTGTTACAAGAATGGTAACGATTTGAATGAAGTCAAGGGAGACGTTGTTAAGTTGGGCAATAAATACGGCCGCTACACACTGAAAAAGAGCAGCACCATCCATATTCACTGTGGCTCCTATTGGAAGGATGAACCGACTGATCTGTTTGGAAACACCATTCTTTTCCTCTACACATTTCATCATTAATGGAAGTGTGGCCGAGCTGGAAAAAGTTCCAAATGCTGTTGCCAGTGCACTCACAATTCCCCACAGGAAGCGGTATGGGTTCTTCCGAGTAAATGCAAAAATAAATTAATGGGGAAAACCAGCAATTCCCTGGTATCAAATGCCCAACAATGCCACAAGAAAATGTACTTCCCCCAAAACTGGTTGAAAAAACCTGGAACAAAATCCTTTCCCCTCTCCCACACATTCCTTC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACATGGTAGACTCCTTTTCC