ORFeome > slc22a5 ORF1 – XORFeome v1.0

slc22a5 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: slc22a5
Gene ID: 484420
Gene Page ID: 484415
ORF Xenbase ID: 17296725

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC056014
Original XGC clone length: 1647

Human orthology & disease relationships

NCBI Entrez ID: 6584
Ensembl gene IDs: ENSG00000197375
Directly associated (OMIM) disease MIM numbers: 212140
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11019
Well Location: F02

Sequences - 5ʹ (forward) EST

Accession: JZ824517
dbEST ID: 79642219
Trimmed Sequence: ATGCGCGACTACGATGAGGCCACGTCTTTCCTGGGAGAATGGGGTCCCTTCCAGCTGTCGGTGTTCTTCCTGCTCAGCGCCAGCATCATCCCCAATGGTTTCACCGGCCTCTCCGCAGTCTTCCTAGCGGCCACCCCCGAGCACCGGTGCCACATACCGGCCGGCGCCAACCTGAGCGAGGCTTGGAGGAACGTGAGCATCCCCCCAGGACAGGACAGTCAGTGCCGCAGATACCGGCTGGAGACTCTGAGCAACTACTCGGCTCTGGGGCTGCTCCCCGGGCGGATGTTGGAATGTGACTGGGATAGAGCAAGAGCCCTGTCTGGATGGCTGGGACTACAGCAAATCCCTTTACCTCTCAACTATAGTCACTGAGTGGAACTTGGTTTGTGAAAATGACTGGAAAGGGCCCCTGACCACCTCGCTGTTCTTTGTGGGAGTACTCATTGGGTCATTCATTTCAGGACAGATGTCAGACAGGTTTGGTAGGAAGAAGGTTTTGTTTGCCACCATGGCTGTGCAGACTGGATTTAGTATTATTCAAGTGTTCTCTGTAAACTGGGAGATGTTCACCGCTTTGTTTGTGATCGTTGGGATGGGACAGATCTCTAATTATGTGGCTGCTTTTATACTTGGTGCAGAAATTCTTGGCAAGTCTGTCCGCATTATATTCTCTACACTAGGAGTGTGCATTTTCTATGCAATTGGCTACATGCTGGCTGCTCTATTTGCTTACTTTATAAGGGACTGGCCGGAGGCGGCTTTTGGGGGCCTACCAATTCCAGGGGCTGTTTTGCATTTCCCTCTTTGTGGGGAATTAACCCCAA
Full Trace Sequence: AATAGTGGATTTTAATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCGCGACTACGATGAGGCCACGTCTTTCCTGGGAGAATGGGGTCCCTTCCAGCTGTCGGTGTTCTTCCTGCTCAGCGCCAGCATCATCCCCAATGGTTTCACCGGCCTCTCCGCAGTCTTCCTAGCGGCCACCCCCGAGCACCGGTGCCACATACCGGCCGGCGCCAACCTGAGCGAGGCTTGGAGGAACGTGAGCATCCCCCCAGGACAGGACAGTCAGTGCCGCAGATACCGGCTGGAGACTCTGAGCAACTACTCGGCTCTGGGGCTGCTCCCCGGGCGGATGTTGGAATGTGACTGGGATAGAGCAAGAGCCCTGTCTGGATGGCTGGGACTACAGCAAATCCCTTTACCTCTCAACTATAGTCACTGAGTGGAACTTGGTTTGTGAAAATGACTGGAAAGGGCCCCTGACCACCTCGCTGTTCTTTGTGGGAGTACTCATTGGGTCATTCATTTCAGGACAGATGTCAGACAGGTTTGGTAGGAAGAAGGTTTTGTTTGCCACCATGGCTGTGCAGACTGGATTTAGTATTATTCAAGTGTTCTCTGTAAACTGGGAGATGTTCACCGCTTTGTTTGTGATCGTTGGGATGGGACAGATCTCTAATTATGTGGCTGCTTTTATACTTGGTGCAGAAATTCTTGGCAAGTCTGTCCGCATTATATTCTCTACACTAGGAGTGTGCATTTTCTATGCAATTGGCTACATGCTGGCTGCTCTATTTGCTTACTTTATAAGGGACTGGCCGGAGGCGGCTTTTGGGGGCCTACCAATTCCAGGGGCTGTTTTGCATTTCCCTCTTTGTGGGGAATTAACCCCAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCGCGACTACGATGAGG

Sequences - 3ʹ (reverse) EST

Accession: JZ829869
dbEST ID: 79647571
Trimmed Sequence: CAATGCCGTGTTTGACAAGACATTGGGTTTTCCATTCTTCTCTCTTTTAAGTCGTTTTCCTGCTTTGTAGCTAAACCCTTTAACTTTGAGCATTTCCTCAATGGTATCTGGTAAAGGCATGCCGTGGCTTTCTGGGAGACATAAAGTAAACATCCCTATAAGCACTGTAAGACTTCCCATTAGGATGAAAGGCAGATATCGGTCGTAGGCACCAAGGTAAACAAAGTAAGGGGACAGGATGCTCCCCATTCTGGATGCCATTGAACTGGCTCCCACACCCATATTTCGTACAACAGTGGGGTACAGTTCGGCAGTGTACACATAAACCATGGAGAAAGCTGAAGTGATACCAAACTTCCCCAGCATGACTAGAACAATGGATAGAACCCCAAGCTCTTGAGGCACTAGCTGTATAAACAGTAAAACCGCTCCTCCCAAAACCAACGTGCTTGCAGTTGAGTATCGTCGAGGGAAACTTCGTAGGAGCAACCACGCAATTACATATGCAGGAACTTCAATGATGGCTGACAGGAAGCAGTTGACATAAGGATCACCATGTAAATTGGGAGTGTTTAGAGACAAACCAAAATATCCCACTGAAATGATCATCCAAAGCAAAATGGATAGAAATGTTATTATGCGAAATATTCCTTNGTTTTCAGGAGGTCGAAGAAATGTATGAAGATTTGGTGTATCAACTTCCTTTTTGCTCTTTGCACCTCTTGTAAAAATTAAAATT
Full Trace Sequence: TGGCGGGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACAATGCCGTGTTTGACAAGACATTGGGTTTTCCATTCTTCTCTCTTTTAAGTCGTTTTCCTGCTTTGTAGCTAAACCCTTTAACTTTGAGCATTTCCTCAATGGTATCTGGTAAAGGCATGCCGTGGCTTTCTGGGAGACATAAAGTAAACATCCCTATAAGCACTGTAAGACTTCCCATTAGGATGAAAGGCAGATATCGGTCGTAGGCACCAAGGTAAACAAAGTAAGGGGACAGGATGCTCCCCATTCTGGATGCCATTGAACTGGCTCCCACACCCATATTTCGTACAACAGTGGGGTACAGTTCGGCAGTGTACACATAAACCATGGAGAAAGCTGAAGTGATACCAAACTTCCCCAGCATGACTAGAACAATGGATAGAACCCCAAGCTCTTGAGGCACTAGCTGTATAAACAGTAAAACCGCTCCTCCCAAAACCAACGTGCTTGCAGTTGAGTATCGTCGAGGGAAACTTCGTAGGAGCAACCACGCAATTACATATGCAGGAACTTCAATGATGGCTGACAGGAAGCAGTTGACATAAGGATCACCATGTAAATTGGGAGTGTTTAGAGACAAACCAAAATATCCCACTGAAATGATCATCCAAAGCAAAATGGATAGAAATGTTATTATGCGAAATATTCCTTNGTTTTCAGGAGGTCGAAGAAATGTATGAAGATTTGGTGTATCAACTTCCTTTTTGCTCTTTGCACCTCTTGTAAAAATTAAAATT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAATGCCGTGTTTGACAAGA