ORFeome > slc25a11 ORF1 – XORFeome v1.0

slc25a11 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: slc25a11
Gene ID: 979678
Gene Page ID: 979672
ORF Xenbase ID: 17296755

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123333
Original XGC clone length: 918

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11084
Well Location: C03

Sequences - 5ʹ (forward) EST

Accession: JZ837464
dbEST ID: 79655166
Trimmed Sequence: ATGGCAGAAGCAGGGAAGCAGCGGACTTCCCCCAAGTCTGTGAAGTTCCTGTTCGGGGGACTGGCAGGGATGGGGGCCACGGTGTTTGTGCAGCCGCTGGACCTGGTGAAGAACCGCATGCAGCTGAGCGGGGAAGGAGCCAAGACGAAGGAGTACAAGACCAGTTTCCACGCAGTGGGCAGTATTCTGCGCAACGAGGGCCTCAGAGGCATCTACACGGGTTTATCGGCGGGGCTGCTGCGCCAGGCCACCTACACCACCACGCGCCTGGGCATATACACCATACTGTTTGAGAAGTTCACAAAGGCTGATGGGACTCCCCCCAACTTCTTTATGAAAGCGGCTATTGGAATGACTGCTGGGGCCACTGGAGCGTTTGTGGGGACACCGGCGGAGGTTGCACTGATCATAATGACTGCGGATGGCAGGATGCCCGTTGATCATAGGAGGGGTTACACCAACGTGTTTAATGCACTAGTGAGGATGACGAGGGAGGAAGGAATAACTACGCTGTGGAGGGGATGTATACCCACCATGGCTCGTGCTGTTGTTGTCGACGCCGCTCACTTTGCCTCCTACTCCCAATCCCAACCGTTCCTGTTAGACTCAAGCTAGCTTTTGGGAAGAGATTCTGTTCCCACTTCGGTTCCCGTGTTGATAATGGGGTAGGGGGGGGGGGGCGGCCGCCGGGCCGTGTCGGCTTTCCGGAACCCGGAATCCGGAAGATGGCGAATAGACCAAGGGGAAAAGCGAAAAAAAAAAAACAGAAAGGAGACGTGGGGGGATGAGGGGGGGTGGGGGGCCC
Full Trace Sequence: TCGGGGGCCAAATAATTGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCAGAAGCAGGGAAGCAGCGGACTTCCCCCAAGTCTGTGAAGTTCCTGTTCGGGGGACTGGCAGGGATGGGGGCCACGGTGTTTGTGCAGCCGCTGGACCTGGTGAAGAACCGCATGCAGCTGAGCGGGGAAGGAGCCAAGACGAAGGAGTACAAGACCAGTTTCCACGCAGTGGGCAGTATTCTGCGCAACGAGGGCCTCAGAGGCATCTACACGGGTTTATCGGCGGGGCTGCTGCGCCAGGCCACCTACACCACCACGCGCCTGGGCATATACACCATACTGTTTGAGAAGTTCACAAAGGCTGATGGGACTCCCCCCAACTTCTTTATGAAAGCGGCTATTGGAATGACTGCTGGGGCCACTGGAGCGTTTGTGGGGACACCGGCGGAGGTTGCACTGATCATAATGACTGCGGATGGCAGGATGCCCGTTGATCATAGGAGGGGTTACACCAACGTGTTTAATGCACTAGTGAGGATGACGAGGGAGGAAGGAATAACTACGCTGTGGAGGGGATGTATACCCACCATGGCTCGTGCTGTTGTTGTCGACGCCGCTCACTTTGCCTCCTACTCCCAATCCCAACCGTTCCTGTTAGACTCAAGCTAGCTTTTGGGAAGAGATTCTGTTCCCACTTCGGTTCCCGTGTTGATAATGGGGTAGGGGGGGGGGGGCGGCCGCCGGGCCGTGTCGGCTTTCCGGAACCCGGAATCCGGAAGATGGCGAATAGACCAAGGGGAAAAGCGAAAAAAAAAAAACAGAAAGGAGACGTGGGGGGATGAGGGGGGGTGGGGGGCCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAGAAGCAGGGAAG

Sequences - 3ʹ (reverse) EST

Accession: JZ837463
dbEST ID: 79655165
Trimmed Sequence: TCCGCTGAGGAACAACTTCTTGTAGTATTTGTTCATCTGCTCCAGGAAAATGAAGGTGAGAACGGTGTGAGGCCCGAGACGCGCGTAATACGGGGTGAAGCCCTTCCACAGGCTGAAGAAGCCCTCGTGCCGCACCACCTTCATCAGCACGTCCAGTCCGTTCTTATATTCGGGTTTCCCATCGATCATGCGCATGTTCTGGATCCTGGTTTTTGCAATGTCGACTGGCATGGAGGCGGCAGTGGTGACTAGCCCACTGATCATACTGGCACAGAAGTGGCACAGAATATCGTCCCCAAAGTAGCCTGAGTCTAACAGGAACTGTTTGGATTGTGAGTAAGAGGCCAACTGAGCGGCGTTGACAACAACAGCACGAGCCATGGTGGGTATACATCCCCTCCACAGCGTAGTTATTCCTTCCTCCCTCGTCATCCTCACTAATGCATTAGACACATTGGTGTAACCCCTCCGCTGATCAACGGGCATCCTGCCCTCCGCAGTCATTCTGATCAATAGAACCCTCCCCCGGCGTCCCACCAACCCAACCAAATCCCCCGCAGTCATTCCCATAACCCCTTTCGTAAATAAATTTGGGGGGAGTGGCGGCACCCCTTTTTTGGCTTGGTGAAACGGTAGGGTGTATAGTGCCCGGCCCCCTCGTTCGGGTTTAAGGTGGCGTGGGGCGGGGCGCCCCCGCCCCCAAAGACCCCCGTTGATAAAT
Full Trace Sequence: GGAAATGTCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATCCGCTGAGGAACAACTTCTTGTAGTATTTGTTCATCTGCTCCAGGAAAATGAAGGTGAGAACGGTGTGAGGCCCGAGACGCGCGTAATACGGGGTGAAGCCCTTCCACAGGCTGAAGAAGCCCTCGTGCCGCACCACCTTCATCAGCACGTCCAGTCCGTTCTTATATTCGGGTTTCCCATCGATCATGCGCATGTTCTGGATCCTGGTTTTTGCAATGTCGACTGGCATGGAGGCGGCAGTGGTGACTAGCCCACTGATCATACTGGCACAGAAGTGGCACAGAATATCGTCCCCAAAGTAGCCTGAGTCTAACAGGAACTGTTTGGATTGTGAGTAAGAGGCCAACTGAGCGGCGTTGACAACAACAGCACGAGCCATGGTGGGTATACATCCCCTCCACAGCGTAGTTATTCCTTCCTCCCTCGTCATCCTCACTAATGCATTAGACACATTGGTGTAACCCCTCCGCTGATCAACGGGCATCCTGCCCTCCGCAGTCATTCTGATCAATAGAACCCTCCCCCGGCGTCCCACCAACCCAACCAAATCCCCCGCAGTCATTCCCATAACCCCTTTCGTAAATAAATTTGGGGGGAGTGGCGGCACCCCTTTTTTGGCTTGGTGAAACGGTAGGGTGTATAGTGCCCGGCCCCCTCGTTCGGGTTTAAGGTGGCGTGGGGCGGGGCGCCCCCGCCCCCAAAGACCCCCGTTGATAAAT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATCCGCTGAGGAACAACTT