ORFeome > slc25a21 ORF1 – XORFeome v1.0

slc25a21 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: slc25a21
Gene ID: 6252182
Gene Page ID: 943811
ORF Xenbase ID: 17296797

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123213
Original XGC clone length: 900

Human orthology & disease relationships

NCBI Entrez ID: 89874
Ensembl gene IDs: ENSG00000183032
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 601815,607330,608093

Library Location

Plate ID: GDExl11089
Well Location: C01

Sequences - 5ʹ (forward) EST

Accession: JZ838277
dbEST ID: 79655979
Trimmed Sequence: ATGCCTTCTCCTACCCATACCAGTTTTTGGACTGAAGCGTCTCAACAGGTCCTGGCAGGTGGATCTGCAGGTCTGGTAGAAATTTGCCTGATGCACCCTCTGGATGTGGTGAAAACTCGGTTTCAGATTCAGAGGAGCAAGTCAGATCCAACAAGTTATAAGAGCTTGGGTGACTGCTTCAAGAAGATTTATCGTTCTGAAGGGCTGCTTGGATTCTACAAAGGGATACTGCCTCCTATCCTAGCAGAGACACCCAAACGTGCTGTAAAGTTCTTCACATTTGAGCAGTATAAGAAGCTTTTGGTTCCACTGTCTCTGCCACCTGCATGGGTGTTTGCAATTGCTGGTTTAGGATCAGGACTTACCGAAGCCATTGTGGTCAATCCATTTGAGGTAGTCAAGGTCGGACTTCAAGCTAACCGTAATGCTTATGCCCAGCAACCATCCTCTTTTGCTCAAGCACGACACATAATAAAAACGCAAGGGATTGGCCTTCGAGGAATTAATAAAGGACTGAGTGCCACACTAGGACGCCATGGTGTGTTTAATATGATCTACTTTGGGTTCTATTTCAATGTAAAGAATGCAGTACCAGTAAATAAAGACACAACTCTGGAGTTCCTCAGAAATTTCATGATTGGTTTGGGCTCTGGGAGCCTGGCCTCCCGTATTAACATTCCGTTTTATGTACCCGAAATTCGGATTTCAAGGGCCACAACCCGAAACCTGGTGTTATTAATTACCCAACCTGCCGGGAAAAACAATAAAAAACGATGTTAAAAAAAAAAAAAAGGGTTTTCCAAGCGGCT
Full Trace Sequence: CGGGGGCCAAATAATGGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCTTCTCCTACCCATACCAGTTTTTGGACTGAAGCGTCTCAACAGGTCCTGGCAGGTGGATCTGCAGGTCTGGTAGAAATTTGCCTGATGCACCCTCTGGATGTGGTGAAAACTCGGTTTCAGATTCAGAGGAGCAAGTCAGATCCAACAAGTTATAAGAGCTTGGGTGACTGCTTCAAGAAGATTTATCGTTCTGAAGGGCTGCTTGGATTCTACAAAGGGATACTGCCTCCTATCCTAGCAGAGACACCCAAACGTGCTGTAAAGTTCTTCACATTTGAGCAGTATAAGAAGCTTTTGGTTCCACTGTCTCTGCCACCTGCATGGGTGTTTGCAATTGCTGGTTTAGGATCAGGACTTACCGAAGCCATTGTGGTCAATCCATTTGAGGTAGTCAAGGTCGGACTTCAAGCTAACCGTAATGCTTATGCCCAGCAACCATCCTCTTTTGCTCAAGCACGACACATAATAAAAACGCAAGGGATTGGCCTTCGAGGAATTAATAAAGGACTGAGTGCCACACTAGGACGCCATGGTGTGTTTAATATGATCTACTTTGGGTTCTATTTCAATGTAAAGAATGCAGTACCAGTAAATAAAGACACAACTCTGGAGTTCCTCAGAAATTTCATGATTGGTTTGGGCTCTGGGAGCCTGGCCTCCCGTATTAACATTCCGTTTTATGTACCCGAAATTCGGATTTCAAGGGCCACAACCCGAAACCTGGTGTTATTAATTACCCAACCTGCCGGGAAAAACAATAAAAAACGATGTTAAAAAAAAAAAAAAGGGTTTTCCAAGCGGCT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCTTCTCCTACCCATA

Sequences - 3ʹ (reverse) EST

Accession: JZ838276
dbEST ID: 79655978
Trimmed Sequence: CCAGTGTTTCTGAAGCCAGGCATAGGAATACTCATATACCAACAACATTACTGCTCCTCCAGGCCCAAGTCGCATTATCTTGGGAAGAAGACCTTTATAAAGAGCTAGGAACCCTTCCTCCTTGTACACTGTAATAATAGTCTTCCAGCAGCTGCGATACTTAATAACACCAGGTTCTGGTTGTGGCCCTTGAATCCGACTTTTGGCTACATCAAACGGGATGTTAATAATGGAGGCCAGGGTCCCAGAGGCCAAACCAATCACGAACTTTCTGAGGAACTCCAGAGTTGCGTCCTTATTTACTGGTACTGCATTCTTTACATTGAAATAGAACCCAAAGTAGATCATATTAAACACACCATGGCGTCCTAGTGTGGCACTCAGTCCTTTATTAATTCCTCGAAGGCCAATCCCTTGCGTTTTTATTATGTGTCGTGCTTGAGCAAAAGAGGATGGTTGCTGGGCATAAGCATTACGGTTAGCTTGAAGTCCGACCTTGACTACCTCAAATGGATTGACCACAATGGCTTCGGTAAATCCTGATCCTAAAACAGCAATTGCAACACCCATGCCCGTGGCAGAGACAGTGGAACCAAAAACTTCCTATACTGCTCAAATGTGAAGAACTTTACAGCACTTTTGGGTGTCTGTGCTAGGGATAGGAGGCAGTATCCCCTTTGTATAATCCAACCAACCCTTCCGAAAACAAAAAATCTTTCTTTAAATCCAATTTACCCAGCCCCCCTAAAAAACTTTGTTTTG
Full Trace Sequence: GGGAAACTGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACCAGTGTTTCTGAAGCCAGGCATAGGAATACTCATATACCAACAACATTACTGCTCCTCCAGGCCCAAGTCGCATTATCTTGGGAAGAAGACCTTTATAAAGAGCTAGGAACCCTTCCTCCTTGTACACTGTAATAATAGTCTTCCAGCAGCTGCGATACTTAATAACACCAGGTTCTGGTTGTGGCCCTTGAATCCGACTTTTGGCTACATCAAACGGGATGTTAATAATGGAGGCCAGGGTCCCAGAGGCCAAACCAATCACGAACTTTCTGAGGAACTCCAGAGTTGCGTCCTTATTTACTGGTACTGCATTCTTTACATTGAAATAGAACCCAAAGTAGATCATATTAAACACACCATGGCGTCCTAGTGTGGCACTCAGTCCTTTATTAATTCCTCGAAGGCCAATCCCTTGCGTTTTTATTATGTGTCGTGCTTGAGCAAAAGAGGATGGTTGCTGGGCATAAGCATTACGGTTAGCTTGAAGTCCGACCTTGACTACCTCAAATGGATTGACCACAATGGCTTCGGTAAATCCTGATCCTAAAACAGCAATTGCAACACCCATGCCCGTGGCAGAGACAGTGGAACCAAAAACTTCCTATACTGCTCAAATGTGAAGAACTTTACAGCACTTTTGGGTGTCTGTGCTAGGGATAGGAGGCAGTATCCCCTTTGTATAATCCAACCAACCCTTCCGAAAACAAAAAATCTTTCTTTAAATCCAATTTACCCAGCCCCCCTAAAAAACTTTGTTTTG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACCAGTGTTTCTGAAGCCAGGCAT