ORFeome > slc25a24 ORF2 – XORFeome v1.0

slc25a24 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: slc25a24
Gene ID: 976248
Gene Page ID: 976242
ORF Xenbase ID: 17296815

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC108882
Original XGC clone length: 1422

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11082
Well Location: H11

Sequences - 5ʹ (forward) EST

Accession: JZ837190
dbEST ID: 79654892
Trimmed Sequence: ATGCTCGAGCAAGTACAGAAATTTCTGCTCTCCAGAGCTGCCTGCGAGGGTTCCGATTCCCATACCAGATATGCAGAGCTTTTCCATAAACTGGATGTTAATAAAGATGGGAAGGTGGATATCCTGGAGCTGCAGGAGGGCCTCAAAGCCATGGGAATGGCAGTTGGCAAAGGAGCAGAAGAGAAAATCGTTGAAGCTGGAGATACTAACAAGGATGGACATTTGGACTTTGGGGAGTTCATGAGATATCTAGAAGAACATGAGAAGAAAATGAAGATTGCCTTTACAAGTCTAGACAAAAACAAGGATGGAAAGATTGAGTCCTCAGAGGTAATGAACTCTCTCAAAACTCTGGGCATCAACATTTCTTTAGACCATGCCGAAAAAATCCTCAAGAGCATGGATTCTGATGGTACTCTCACAGTGGACTGGAATGAATGGAGGGACCACTTCTTGTTCAACCCAGCTGATAACATCCAACAAATTATTCGATTCTGGAAACACTCAACGGTGCTGGACATAGGGGACAGCCTTACTATCCCTGATGAGTTTACAGAGGAAGAGAAGAAGACTGGGCAGTGGTGGAAGCACCTGTTGGCCGGTGGAATGGGCGGGGCTGTGTCTCGGACAGGAACTGCTCCCTTGGACCTTCTGGAAGTCATGATGCAGGTTCCTGGATCCGAGGGAAATTCGAAAGATAATTACCCGGTCTTAAACCAGATGATTAAAAAAAAGGAGGCGGTGCAGTGCCCTTTTGTCCTATTTAAATGGGGGTTTATGGGTGGTTGAGAAATTTCTCCTCTATATCAACGACCTGTGCTAACACTTC
Full Trace Sequence: GGAGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCTCGAGCAAGTACAGAAATTTCTGCTCTCCAGAGCTGCCTGCGAGGGTTCCGATTCCCATACCAGATATGCAGAGCTTTTCCATAAACTGGATGTTAATAAAGATGGGAAGGTGGATATCCTGGAGCTGCAGGAGGGCCTCAAAGCCATGGGAATGGCAGTTGGCAAAGGAGCAGAAGAGAAAATCGTTGAAGCTGGAGATACTAACAAGGATGGACATTTGGACTTTGGGGAGTTCATGAGATATCTAGAAGAACATGAGAAGAAAATGAAGATTGCCTTTACAAGTCTAGACAAAAACAAGGATGGAAAGATTGAGTCCTCAGAGGTAATGAACTCTCTCAAAACTCTGGGCATCAACATTTCTTTAGACCATGCCGAAAAAATCCTCAAGAGCATGGATTCTGATGGTACTCTCACAGTGGACTGGAATGAATGGAGGGACCACTTCTTGTTCAACCCAGCTGATAACATCCAACAAATTATTCGATTCTGGAAACACTCAACGGTGCTGGACATAGGGGACAGCCTTACTATCCCTGATGAGTTTACAGAGGAAGAGAAGAAGACTGGGCAGTGGTGGAAGCACCTGTTGGCCGGTGGAATGGGCGGGGCTGTGTCTCGGACAGGAACTGCTCCCTTGGACCTTCTGGAAGTCATGATGCAGGTTCCTGGATCCGAGGGAAATTCGAAAGATAATTACCCGGTCTTAAACCAGATGATTAAAAAAAAGGAGGCGGTGCAGTGCCCTTTTGTCCTATTTAAATGGGGGTTTATGGGTGGTTGAGAAATTTCTCCTCTATATCAACGACCTGTGCTAACACTTC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCTCGAGCAAGTACAGAA

Sequences - 3ʹ (reverse) EST

Accession: JZ837189
dbEST ID: 79654891
Trimmed Sequence: GATACCCAGCTGGATCTTCATCTTCTCGTAAACCACATAGCTTATACTGACAGCAGGCAACACTTTCAGGAAATTAGGCGCAATGCCTGTATACAGCCCAAAAAAACCTTCTTTGGCGACAATCTTTCGGAATAGGCCTCCCATGTTTAGCTGTGGAGCACCCTCAATAGATGCTTGTGCTTGCATTCTTGTCCTGATGAGAGCTAACGGGTAGCTTGCCAGCTGGCCACATGTACTGGACACAGTGCCACAACCCAACAAGACCAGCACCCCAGGGTTGGCAGAGTCTTTTGCATAATTCTGCAGCCAATAGTTTTTGAGTGTCTCATAAATAGCAAGGTCAATGCCTGCATAAGGGATGATTCCAAGGATGTTGGGGATGTAGCCTTTGTAAAAGGCCAGTATGCCTTCCTTTTGCATAATCTTCTTAGCACAGTCAAACATTCCAGAGTATTGTCCTGTTTTCCCCACAGCCAAACGGGTTTTTAGAACCTCCATAGGGTAGATTGAGGTTTGTGCTGTTGCTCCGGCCAGAGATCCAGCTATAAATCGTTCTGCCCGTTCCAACTTGCCACTCTCTGACGTGAAAAGTTTCTTATACTGCTCATATGCCCAGAAATTTATTGCCTGTCCTCAGGGCCAATTTTAATCATAATTAACCCCATTTTCCTCTCCAAAGGGGATCGAAGGGCCTCCTTTGTTTTTTACATCCTGTTTT
Full Trace Sequence: CGGGAAACGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGATACCCAGCTGGATCTTCATCTTCTCGTAAACCACATAGCTTATACTGACAGCAGGCAACACTTTCAGGAAATTAGGCGCAATGCCTGTATACAGCCCAAAAAAACCTTCTTTGGCGACAATCTTTCGGAATAGGCCTCCCATGTTTAGCTGTGGAGCACCCTCAATAGATGCTTGTGCTTGCATTCTTGTCCTGATGAGAGCTAACGGGTAGCTTGCCAGCTGGCCACATGTACTGGACACAGTGCCACAACCCAACAAGACCAGCACCCCAGGGTTGGCAGAGTCTTTTGCATAATTCTGCAGCCAATAGTTTTTGAGTGTCTCATAAATAGCAAGGTCAATGCCTGCATAAGGGATGATTCCAAGGATGTTGGGGATGTAGCCTTTGTAAAAGGCCAGTATGCCTTCCTTTTGCATAATCTTCTTAGCACAGTCAAACATTCCAGAGTATTGTCCTGTTTTCCCCACAGCCAAACGGGTTTTTAGAACCTCCATAGGGTAGATTGAGGTTTGTGCTGTTGCTCCGGCCAGAGATCCAGCTATAAATCGTTCTGCCCGTTCCAACTTGCCACTCTCTGACGTGAAAAGTTTCTTATACTGCTCATATGCCCAGAAATTTATTGCCTGTCCTCAGGGCCAATTTTAATCATAATTAACCCCATTTTCCTCTCCAAAGGGGATCGAAGGGCCTCCTTTGTTTTTTACATCCTGTTTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGATACCCAGCTGGATCTT