ORFeome > slc27a6 ORF1 – XORFeome v1.0

slc27a6 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: slc27a6
Gene ID: 866114
Gene Page ID: 491991
ORF Xenbase ID: 17296941

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC126053
Original XGC clone length: 1866

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11085
Well Location: C12

Sequences - 5ʹ (forward) EST

Accession: JZ837771
dbEST ID: 79655473
Trimmed Sequence: ATGGCTCTCCCTTGGATCACAGCATTTCTGGCTGGCTTGTTAGCCCTGCATTTTCTACAAAGGAGATTTTTCCCTTATTTTTGGGCTGACCTCATATACTTCCTGAAAGTAGTGCGATATGGACTTCGGATTGAGACGTACAAAAGGACAGGCAGCGTCGTGACCGTGGTCGAAAACTTTATACAGCAGGCCAAACGGGTGCCAAACAAACCCTTCCTAATATTTCAGGAACAGGTGCATACATACCGAGATGTGGATAAAAGGAGCAATCAGGTGGCTCAGGTGTTCATGAAGTATTCACCACTGAAAAAGGAGGATACGGTAGCTATGCTTATGAGCAACGAGCCAGACTTTGTGAATGTATGGTTTGGCTTGGCCAAGCTTGGCTTTCGGGTTGCATTTCTGAACTACAACGTTCGCTCCAGGTCGCTGTTGCATTGCTTCCACAGTTGTGGAGCGAAGATGCTGGTTGTGGGAGCAGATATGCTAGAAACACTAGAGGAAATCCTCCCGAATTTAAAGGAAGATAACATCATTGTGTGTGTAATGGCGAAAGAAGTTTCAATCCCATATGTAAATACTATTATGTACAAACTGGAAACTTGTAACAGAATGACCCAGTAACCTAACCACTTTCCTCATGTAACCAAGCATCAGAACCGCAACTCCTTTAAATTTTCAACTTCTGGAAC
Full Trace Sequence: TCGGGGCCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTCTCCCTTGGATCACAGCATTTCTGGCTGGCTTGTTAGCCCTGCATTTTCTACAAAGGAGATTTTTCCCTTATTTTTGGGCTGACCTCATATACTTCCTGAAAGTAGTGCGATATGGACTTCGGATTGAGACGTACAAAAGGACAGGCAGCGTCGTGACCGTGGTCGAAAACTTTATACAGCAGGCCAAACGGGTGCCAAACAAACCCTTCCTAATATTTCAGGAACAGGTGCATACATACCGAGATGTGGATAAAAGGAGCAATCAGGTGGCTCAGGTGTTCATGAAGTATTCACCACTGAAAAAGGAGGATACGGTAGCTATGCTTATGAGCAACGAGCCAGACTTTGTGAATGTATGGTTTGGCTTGGCCAAGCTTGGCTTTCGGGTTGCATTTCTGAACTACAACGTTCGCTCCAGGTCGCTGTTGCATTGCTTCCACAGTTGTGGAGCGAAGATGCTGGTTGTGGGAGCAGATATGCTAGAAACACTAGAGGAAATCCTCCCGAATTTAAAGGAAGATAACATCATTGTGTGTGTAATGGCGAAAGAAGTTTCAATCCCATATGTAAATACTATTATGTACAAACTGGAAACTTGTAACAGAATGACCCAGTAACCTAACCACTTTCCTCATGTAACCAAGCATCAGAACCGCAACTCCTTTAAATTTTCAACTTCTGGAAC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTCTCCCTTGGATCAC

Sequences - 3ʹ (reverse) EST

Accession: JZ837770
dbEST ID: 79655472
Trimmed Sequence: GAGTTTTATCTGCCCGCTCAGGATTTTTTCATAAATGTCTTTGGTCAATGGGACATAGGATTTTTCAGAATCATCTAAGAAATAAAGTGGATCGGGCACTACTGATGGATTAAATCCTTGTTCCACAAGACGGAATTTTTGCTGTTTGAATGTTCCAGTCATCTCCATATTGTCCTGTAGTCTTAGAAATCGAGGACGAGCATAGCCAGGTAGGTAGGTCACAATTTGCTCATAAATGCCCTTAACATCTAATGTTTCCTCCGGTTTTAATATGATGGATGCCATCCCCACTTTTCCTTCATGTTCTGGAATGGCCACCCCGTATATATTGGCTTCTTGGATGAAGTTCAGCATTCCAATAATGTCGGCTACTTCGGTAGTAGCAACATTTTCTCCTTTCCACCTGAAGGTGTCGCCAATCCTGTCCCGAAAATAAAGAAAATTTTCATGATCCTGGACCATCAAATCACCGGTGTTAAAATAAACATCCCCTTTTCTGAAGACGTTGCATAACAGCTTTTTTGTTGTGTGGTTTTTATTTCCCGCATAGCCGAAGAAAGGGTTGTTTTGGTTTACCTTTGATATTAAAAGCCCGGTTTCCCCTTTTTTAACACGTTCACACCAGCCGTGCTTATTAATAATTGGCTCATCTTTTTGAATGTCGTATTTTATCAATTCAAATGGAAACAGCAGCTTGTAAAAATATTTGATCGCCCAACAGATCCAATTTTTCCGGTGTGATTCATAAAACAAATGTTTCCTTCAGTAGCACCATAAAGCTCACACAACTTTATATTCCCAAATTCTCTAATGAATTCCTTTCATACATTACTACCTACCCCATTTTCGAAATGGCATACGGACTTTGTGAATCCTTTTCCCCTTCTTTTCAAAGGCTGGTAAAAGAAATAACGAAATAATTCCCCAATAATACTGAAAAAAGGAAAGATTAAATTTTTTAACATCCAATCAAAACTGGCCTTTCCTAAAAATGTGTTTTTTAAA
Full Trace Sequence: GGGCCAGGGAAACCGTCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGAGTTTTATCTGCCCGCTCAGGATTTTTTCATAAATGTCTTTGGTCAATGGGACATAGGATTTTTCAGAATCATCTAAGAAATAAAGTGGATCGGGCACTACTGATGGATTAAATCCTTGTTCCACAAGACGGAATTTTTGCTGTTTGAATGTTCCAGTCATCTCCATATTGTCCTGTAGTCTTAGAAATCGAGGACGAGCATAGCCAGGTAGGTAGGTCACAATTTGCTCATAAATGCCCTTAACATCTAATGTTTCCTCCGGTTTTAATATGATGGATGCCATCCCCACTTTTCCTTCATGTTCTGGAATGGCCACCCCGTATATATTGGCTTCTTGGATGAAGTTCAGCATTCCAATAATGTCGGCTACTTCGGTAGTAGCAACATTTTCTCCTTTCCACCTGAAGGTGTCGCCAATCCTGTCCCGAAAATAAAGAAAATTTTCATGATCCTGGACCATCAAATCACCGGTGTTAAAATAAACATCCCCTTTTCTGAAGACGTTGCATAACAGCTTTTTTGTTGTGTGGTTTTTATTTCCCGCATAGCCGAAGAAAGGGTTGTTTTGGTTTACCTTTGATATTAAAAGCCCGGTTTCCCCTTTTTTAACACGTTCACACCAGCCGTGCTTATTAATAATTGGCTCATCTTTTTGAATGTCGTATTTTATCAATTCAAATGGAAACAGCAGCTTGTAAAAATATTTGATCGCCCAACAGATCCAATTTTTCCGGTGTGATTCATAAAACAAATGTTTCCTTCAGTAGCACCATAAAGCTCACACAACTTTATATTCCCAAATTCTCTAATGAATTCCTTTCATACATTACTACCTACCCCATTTTCGAAATGGCATACGGACTTTGTGAATCCTTTTCCCCTTCTTTTCAAAGGCTGGTAAAAGAAATAACGAAATAATTCCCCAATAATACTGAAAAAAGGAAAGATTAAATTTTTTAACATCCAATCAAAACTGGCCTTTCCTAAAAATGTGTTTTTTAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGAGTTTTATCTGCCCGCT