ORFeome > slc2a14 ORF1 – XORFeome v1.0

slc2a14 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6256175
Gene Page ID:
ORF Xenbase ID: 17296971

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC128693
Original XGC clone length: 1479

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11083
Well Location: D08

Sequences - 5ʹ (forward) EST

Accession: JZ837388
dbEST ID: 79655090
Trimmed Sequence: ATGGATCCCAGCAGCAAGAAGGTGACGGGCCGCCTCATGTTGGCTGTGGGAGGAGCAGTGCTCGGATCACTGCAGTTCGGCTATAACACTGGTGTCATCAACGCCCCCCAGAAGGTTATTGAGGAGTTCTACAATCAAACATGGAACCACCGCTACGGAGAGCCCATCCCATCCACCACACTCACCACGCTTTGGTCTCTCTCCGTGGCCATCTTCTCTGTCGGGGGCATGATTGGTTCCTTCTCTGTCGGCCTCTTTGTTAATCGCTTTGGCAGGCGGAACTCCATGCTGATGATGAACCTGTTGGCCTTTGTGGCTGCTGTGCTTATGGGCTTCTCCAAACTGGGCAAGTCCTTTGAGATGCTGATCCTGGGCCGCTTCATCATCGGTGTGTACTGCGGCCTGACTACTGGCTTTGTGCCCATGTATGTGGGAGAGGTGTCACCTACAGCTCTACGTGGAGCCCTAGGCACACTGCACCAGCTGGGAATCGTCGTTGGCATCCTTATTGCCCAGGTGTTTGGCTTAGACTCCATCATGGGCAATGCAGACTTGTGGCCTCTGCTGCTCAGTGTCATCTTCATCCCACCCCTGCTACAGTGTATCCTGTTGCCCTTCTTCCCCCAAACCCCCCCTTCCTGCTCATCATTCGTACCAAGAAAAACCGGGCCAAAATGTGCTGAAGAACTTTCAAAGAAAACCCAATGTAACCCAAAACCTGGAGAAAATAAAAAAAAAGGTTCGGCAATGAATGCGGAAAAAAAAAGTCCCCATCCTTTAAACTTTTTTCCCTTTCCCCCCCGATCCGCCCCGCCCCAC
Full Trace Sequence: GGCGGGCCCAAATAATAGATTTTANTTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGATCCCAGCAGCAAGAAGGTGACGGGCCGCCTCATGTTGGCTGTGGGAGGAGCAGTGCTCGGATCACTGCAGTTCGGCTATAACACTGGTGTCATCAACGCCCCCCAGAAGGTTATTGAGGAGTTCTACAATCAAACATGGAACCACCGCTACGGAGAGCCCATCCCATCCACCACACTCACCACGCTTTGGTCTCTCTCCGTGGCCATCTTCTCTGTCGGGGGCATGATTGGTTCCTTCTCTGTCGGCCTCTTTGTTAATCGCTTTGGCAGGCGGAACTCCATGCTGATGATGAACCTGTTGGCCTTTGTGGCTGCTGTGCTTATGGGCTTCTCCAAACTGGGCAAGTCCTTTGAGATGCTGATCCTGGGCCGCTTCATCATCGGTGTGTACTGCGGCCTGACTACTGGCTTTGTGCCCATGTATGTGGGAGAGGTGTCACCTACAGCTCTACGTGGAGCCCTAGGCACACTGCACCAGCTGGGAATCGTCGTTGGCATCCTTATTGCCCAGGTGTTTGGCTTAGACTCCATCATGGGCAATGCAGACTTGTGGCCTCTGCTGCTCAGTGTCATCTTCATCCCACCCCTGCTACAGTGTATCCTGTTGCCCTTCTTCCCCCAAACCCCCCCTTCCTGCTCATCATTCGTACCAAGAAAAACCGGGCCAAAATGTGCTGAAGAACTTTCAAAGAAAACCCAATGTAACCCAAAACCTGGAGAAAATAAAAAAAAAGGTTCGGCAATGAATGCGGAAAAAAAAAGTCCCCATCCTTTAAACTTTTTTCCCTTTCCCCCCCGATCCGCCCCGCCCCAC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGATCCCAGCAGCAAGAA

Sequences - 3ʹ (reverse) EST

Accession: JZ837387
dbEST ID: 79655089
Trimmed Sequence: CACTTGGGAGTCCGCCCCCAGAGGGTGGAAGAGCTCCTCGGGTGTCTTGTCACTTTGGCTGGCACCCCCCTGCCGGAAGCCGGAAGCGATCTCATCGAAGGTTCGGCCTTTGGTCTCAGGGACTTTGAAGTAGGTGAAGATGAAGAAGAGCACGAGGAGCACCGTGAAGATGATGAAGACGTAGGGGCCGCACAGTTGCTCCACATACTGGAAGCACATGCCCACAATGAAGTTTGAGGTCCAGTTGGAGAAGCCAGCCACAGCAATAGCAGCAGGACGGGGCCCCTGGCTGAACAGCTCGGCCACAATGAACCATGGAATAGGACCAGGGCCTACTTCAAAGAAGGCCACAAAGCCAAAGATGGCCACGATGCTCAGATAGGACATCCAAGGCAGCCGTTCCAGCAAGGCCAGGGCGATGGTCATGAGCACAGCACAGCCTGCCATGCCAGCCAGGCCAATGAGGTGCAGGGTCCGTCGTCCAGCTCGCTCTACAACAAACAGCGACACCACAGTGAAAGCCGTGTTGACGATACCGGAGCCGATTGTGGCGTACACAGGCTGCTGCACACCTGCCTTCTCCAAAATGCTCGTTTGAGTAATAAAAACCCGCCATTAATACCCAACACCTGCTGGGGACGCTGCCGCCACCACACCAATAAGGAGAGGGCGTGGGGGTGGGGCGGGGTGGGGGGAAGAGCCCCCAAAAAAAGTTAGCCTGTTTTTCCTCCCCCATACCTTTTGCGCCAACACGGTCTC
Full Trace Sequence: AAACTGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACACTTGGGAGTCCGCCCCCAGAGGGTGGAAGAGCTCCTCGGGTGTCTTGTCACTTTGGCTGGCACCCCCCTGCCGGAAGCCGGAAGCGATCTCATCGAAGGTTCGGCCTTTGGTCTCAGGGACTTTGAAGTAGGTGAAGATGAAGAAGAGCACGAGGAGCACCGTGAAGATGATGAAGACGTAGGGGCCGCACAGTTGCTCCACATACTGGAAGCACATGCCCACAATGAAGTTTGAGGTCCAGTTGGAGAAGCCAGCCACAGCAATAGCAGCAGGACGGGGCCCCTGGCTGAACAGCTCGGCCACAATGAACCATGGAATAGGACCAGGGCCTACTTCAAAGAAGGCCACAAAGCCAAAGATGGCCACGATGCTCAGATAGGACATCCAAGGCAGCCGTTCCAGCAAGGCCAGGGCGATGGTCATGAGCACAGCACAGCCTGCCATGCCAGCCAGGCCAATGAGGTGCAGGGTCCGTCGTCCAGCTCGCTCTACAACAAACAGCGACACCACAGTGAAAGCCGTGTTGACGATACCGGAGCCGATTGTGGCGTACACAGGCTGCTGCACACCTGCCTTCTCCAAAATGCTCGTTTGAGTAATAAAAACCCGCCATTAATACCCAACACCTGCTGGGGACGCTGCCGCCACCACACCAATAAGGAGAGGGCGTGGGGGTGGGGCGGGGTGGGGGGAAGAGCCCCCAAAAAAAGTTAGCCTGTTTTTCCTCCCCCATACCTTTTGCGCCAACACGGTCTC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACACTTGGGAGTCCGCCC