ORFeome > slc2a9 ORF2 – XORFeome v1.0

slc2a9 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: slc2a9
Gene ID: 5883716
Gene Page ID: 5883702
ORF Xenbase ID: 17297007

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC124974
Original XGC clone length: 1545

Human orthology & disease relationships

NCBI Entrez ID: 56606
Ensembl gene IDs: ENSG00000109667
Directly associated (OMIM) disease MIM numbers: 612076
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11083
Well Location: F06

Sequences - 5ʹ (forward) EST

Accession: JZ837408
dbEST ID: 79655110
Trimmed Sequence: ATGGATAAAAATAAGAGAGTTTTTGCTGCCAAGCAAGTGACAGGGAATCTGACATTTTCACTGTTGGCTGTTTCCTTGCTCTCCTCTTTGGGCTCCTCTATGCTCTATGGATACAACTTAGCTGTGGTCAACGCCCCTTCCGAGTATATAAAATCATTTTACAATGTCACATGGAATGAACGATATGGGCAACCACTTGCACAAAGTCCATTGACGCTCATGTACTCTTTGACTGTGTCGGTCTTTGCTCTGGGAGGGATGCTTGGCTCTCTGCTTGTTGGAATCCTGGTGTCCAGGTTTGGAAGGAAAGGGACAATTATAAGGAGCAGTCCCCTGGTCTTTATTGCGGGCGGCTTGATGGGACTCAGTCGTGTCTTTTCATCCCCAGAGATGGTAATCATTGGGAGGTTCGTTACAGGCATCCACTCAGGTATTTCTCTCAGTGTGGTACCGATGTATTTAGGAGAAATTTCCCCAAAGAACTTGCGTGGACTTTTAGGACTAGTGCCAAGTCTGTTCATTTGCTTTGGTGTATTTTCTGCACAGGTTTTGGGTCTCCCTGAGCTCTTGGGGCAGGATGAGACATGGCCACTTTTCCTTTCTCTGGTTGTGGTACCTACTTTTGTTCAGCTTGTTCTCCTGCCTTGGTTTCCAGAAAGCCCTCGTTATCTTCTCCTTGATAAAAGCAATGTCCACGCCACTTTTGATTCCACTGAAGTTGTTTCCTTTGGAAAATATAAATGTTCAGAATGTCAATGAAGAAAAATCAAAAAAAACAAAAAACCCTTTTCTAAATGTTTTTAAAACTGTCCCCAAATTTTT
Full Trace Sequence: GGCGGCACCAAATAATGGATTTTATTTNTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGATAAAAATAAGAGAGTTTTTGCTGCCAAGCAAGTGACAGGGAATCTGACATTTTCACTGTTGGCTGTTTCCTTGCTCTCCTCTTTGGGCTCCTCTATGCTCTATGGATACAACTTAGCTGTGGTCAACGCCCCTTCCGAGTATATAAAATCATTTTACAATGTCACATGGAATGAACGATATGGGCAACCACTTGCACAAAGTCCATTGACGCTCATGTACTCTTTGACTGTGTCGGTCTTTGCTCTGGGAGGGATGCTTGGCTCTCTGCTTGTTGGAATCCTGGTGTCCAGGTTTGGAAGGAAAGGGACAATTATAAGGAGCAGTCCCCTGGTCTTTATTGCGGGCGGCTTGATGGGACTCAGTCGTGTCTTTTCATCCCCAGAGATGGTAATCATTGGGAGGTTCGTTACAGGCATCCACTCAGGTATTTCTCTCAGTGTGGTACCGATGTATTTAGGAGAAATTTCCCCAAAGAACTTGCGTGGACTTTTAGGACTAGTGCCAAGTCTGTTCATTTGCTTTGGTGTATTTTCTGCACAGGTTTTGGGTCTCCCTGAGCTCTTGGGGCAGGATGAGACATGGCCACTTTTCCTTTCTCTGGTTGTGGTACCTACTTTTGTTCAGCTTGTTCTCCTGCCTTGGTTTCCAGAAAGCCCTCGTTATCTTCTCCTTGATAAAAGCAATGTCCACGCCACTTTTGATTCCACTGAAGTTGTTTCCTTTGGAAAATATAAATGTTCAGAATGTCAATGAAGAAAAATCAAAAAAAACAAAAAACCCTTTTCTAAATGTTTTTAAAACTGTCCCCAAATTTTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGATAAAAATAAGAGAGTTTTT

Sequences - 3ʹ (reverse) EST

Accession: JZ837407
dbEST ID: 79655109
Trimmed Sequence: AGAGAATTCAAAGGAGCTGCTCTCTATTGCGCCGTATCCATTCAGCTTCCTAAGTTTTAAATCATCTACAATCACTTCGTGAGTCACCAGGGACTTTGAGGAGGAAAACATCAGACTAATTTCCATAAAAGTTTTGTTCTTGGTCTCAGGAATGATGAAGTAAACAAAGGCAGCTACAAACAAACAAACTCCGCAAAATACCATATAGCAGAACGCTCCAGCCGATATCTGAAGGAAAGGAAAGACAAATCCTACAGTAAAGTTGGATAACCAGTTTAGTGTCCCTCCCACAATGTAGGCAGCAGGGCGATGAGACTGTGTGAATAGTTCTCCAGTGATGATAAATGGGAGTCCAGCTGGTCCTATGCAAAACCCAGCAATTATACCAATCACACAGGCCACGCTGACATAGCGCATCACAGGAATCCTGGCCTGAAACACCAAAGCTAATGTGATTCCAGCACAGCAGAAACCCATGAAACTGAATCCACCAATAATAAGAGGTCGTCTGCCCAGTTTTTCAACAGTAAAACACCCAATCAAGCCTGCAACTATCTCAATGGCACCAGTCCCCACTGTTGTGTAAGGGATTTCAGCCAGTGGAATTCCTGCATTCTCAAATATGGAGTTGGTATAGAACCAGATAGCATCTATTTCCAGAAAGCTGCATTCCCATATTAATCACGACAACGGAAAAATCTTGCCAAAAAAGGGTACGGTCAGAAAGAAAACGGGGCAAACTGAAAAAGATTCTAAACCACCTTGAAA
Full Trace Sequence: AAAAAGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGAGAATTCAAAGGAGCTGCTCTCTATTGCGCCGTATCCATTCAGCTTCCTAAGTTTTAAATCATCTACAATCACTTCGTGAGTCACCAGGGACTTTGAGGAGGAAAACATCAGACTAATTTCCATAAAAGTTTTGTTCTTGGTCTCAGGAATGATGAAGTAAACAAAGGCAGCTACAAACAAACAAACTCCGCAAAATACCATATAGCAGAACGCTCCAGCCGATATCTGAAGGAAAGGAAAGACAAATCCTACAGTAAAGTTGGATAACCAGTTTAGTGTCCCTCCCACAATGTAGGCAGCAGGGCGATGAGACTGTGTGAATAGTTCTCCAGTGATGATAAATGGGAGTCCAGCTGGTCCTATGCAAAACCCAGCAATTATACCAATCACACAGGCCACGCTGACATAGCGCATCACAGGAATCCTGGCCTGAAACACCAAAGCTAATGTGATTCCAGCACAGCAGAAACCCATGAAACTGAATCCACCAATAATAAGAGGTCGTCTGCCCAGTTTTTCAACAGTAAAACACCCAATCAAGCCTGCAACTATCTCAATGGCACCAGTCCCCACTGTTGTGTAAGGGATTTCAGCCAGTGGAATTCCTGCATTCTCAAATATGGAGTTGGTATAGAACCAGATAGCATCTATTTCCAGAAAGCTGCATTCCCATATTAATCACGACAACGGAAAAATCTTGCCAAAAAAGGGTACGGTCAGAAAGAAAACGGGGCAAACTGAAAAAGATTCTAAACCACCTTGAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGAGAATTCAAAGGAGCTGC