ORFeome > slc30a5 ORF1 – XORFeome v1.0

slc30a5 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: slc30a5
Gene ID: 962728
Gene Page ID: 962721
ORF Xenbase ID: 17297025

ORF full-length analysis tests

Full-Length confidence: medium
Original XGC clone accession: BC153776
Original XGC clone length: 1350

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11092
Well Location: E10

Sequences - 5ʹ (forward) EST

Accession: JZ839008
dbEST ID: 79656710
Trimmed Sequence: ATGAATAAGCCTGCGCACCACCAAAGTACTGAACATGTGCTTTCTGGAGGTGTAGTGGTCAGTGCCATCTTCTTCATTCTGTCTGCACAAATCTTGGCATCCTCTTCAAGGAAAGGACAGAAGGGCACGCTGGTGGGTTACTCCCCTGAGGGCACACCGCTGTATAACTTTATGGGAGATGCTTTGCACAGCACTTCCCCCTCCATGCCCAGGTTCCTGAAAGATTCACTGAAGCAAATCCTGGAAGAGTACGACTCCAGACAGATCTTCTATTTCCTGTGTCTGAATCTGGCTTTCACGTTTGTGGAACTCTTCTATGGCGTGTGGACCAATAGTCTGGGCTTATTATCTGACGGATTCCACATGTTGTTTGACTGCTCTGCATTAGTGATGGGCCTTATTGCTGCATTAATGACTCGCTGGAAAGCAACCCGAATCTTTTCATACGGGTATGGCCGGGTAGAAATTCTGTCTGGATTTATCAATGGTCTGTTTCTGATGGTTATAGCATTTTTCGTGTTTATTGAGGCGGTGGCCAGGATATTTGACCCTCCAGATATCAATACAGACATGCTTACTCCTGTCTCAGTTGGAGGACTGATCGTAAACCTTGGTCGGTATCTGTGCTTTTAGCCATGCCCATTCCCATGGGGCTTCTCCGAGGGAGGGTGTGCGTTCTCGTGATTCTGGGCAATGCTCGCCCTGGACCCAGTCATGGGGCCCACCCACTCAAAAACTGAACCATGAACATTCCCCATAAGCCTGGAGCTTACCCACAATCATGAAAACCTCTCAGGAATTCCTCCCTGGAAATTGGGGTGGAAGTTGAAAGATAAAA
Full Trace Sequence: GACCCCAAATAATAGAATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAATAAGCCTGCGCACCACCAAAGTACTGAACATGTGCTTTCTGGAGGTGTAGTGGTCAGTGCCATCTTCTTCATTCTGTCTGCACAAATCTTGGCATCCTCTTCAAGGAAAGGACAGAAGGGCACGCTGGTGGGTTACTCCCCTGAGGGCACACCGCTGTATAACTTTATGGGAGATGCTTTGCACAGCACTTCCCCCTCCATGCCCAGGTTCCTGAAAGATTCACTGAAGCAAATCCTGGAAGAGTACGACTCCAGACAGATCTTCTATTTCCTGTGTCTGAATCTGGCTTTCACGTTTGTGGAACTCTTCTATGGCGTGTGGACCAATAGTCTGGGCTTATTATCTGACGGATTCCACATGTTGTTTGACTGCTCTGCATTAGTGATGGGCCTTATTGCTGCATTAATGACTCGCTGGAAAGCAACCCGAATCTTTTCATACGGGTATGGCCGGGTAGAAATTCTGTCTGGATTTATCAATGGTCTGTTTCTGATGGTTATAGCATTTTTCGTGTTTATTGAGGCGGTGGCCAGGATATTTGACCCTCCAGATATCAATACAGACATGCTTACTCCTGTCTCAGTTGGAGGACTGATCGTAAACCTTGGTCGGTATCTGTGCTTTTAGCCATGCCCATTCCCATGGGGCTTCTCCGAGGGAGGGTGTGCGTTCTCGTGATTCTGGGCAATGCTCGCCCTGGACCCAGTCATGGGGCCCACCCACTCAAAAACTGAACCATGAACATTCCCCATAAGCCTGGAGCTTACCCACAATCATGAAAACCTCTCAGGAATTCCTCCCTGGAAATTGGGGTGGAAGTTGAAAGATAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAATAAGCCTGCGCACCACCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ839007
dbEST ID: 79656709
Trimmed Sequence: CATGATATAAGTCCCATCCTTGTAGTATGTGATAGTGTCCATCTGTTTGGTCATGACAAGGACATCTTGGAATGCGGTACTAAGGCCAGACATATGCTGGAAGTAAGCTTCTTTCTCCACTTGTACAGTGAGGTTATTGACTCCGGCATCCTTTAGAATGGACGTTACCTGCTGGATGATCCTCTGCTCTACAACATCCGACATCACCTGAACATGTATAGTCCCTGCAACAAGAGAGGCAGAATGGCGCCAGAAATGTGGATCCCGGTAGGAGATTAGACCATCAATGTTAGAAATCTTTTCAAGGGCAATGTTTACTCCTTTTTCAGTTTCTTGTGGTATCCTCAGAAGAATCACCTGGCAGGCATCGTTAAGCAAAGGCAGAACACTGGCAAATATTAATACAGAAATGAATAGTGAGCATAAGGGGTCTGCAATGAGCCAGCCGAACTGTCGAATCAGGATGGTGGATACAATGACTCCAACGCTTCCNAGCGTATCTGCCAATACATGTAAGAATACACCTCTCATATTTGCATTCATCCCAACTCCAGCAGACCCATGAGAGTGTCCATGATTGTGGGTATGTCCATGGTTTATGGCATGTCCATGGTCACTATGTAAGTGGTTGTGCCCTTGACTGTGTCCATGGTGAGAATGGCCATAATCAAAAAAAGAACACCCTCCTCCAAAAACCCCCCAGGGAAAAGGGGCATGGGTTAAAAACAAAAAAAACCCAACAAAGGTTTATCCAAAAC
Full Trace Sequence: GAAAAAGGCTATTGACCATGTAATACGACTCACTATANGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACATGATATAAGTCCCATCCTTGTAGTATGTGATAGTGTCCATCTGTTTGGTCATGACAAGGACATCTTGGAATGCGGTACTAAGGCCAGACATATGCTGGAAGTAAGCTTCTTTCTCCACTTGTACAGTGAGGTTATTGACTCCGGCATCCTTTAGAATGGACGTTACCTGCTGGATGATCCTCTGCTCTACAACATCCGACATCACCTGAACATGTATAGTCCCTGCAACAAGAGAGGCAGAATGGCGCCAGAAATGTGGATCCCGGTAGGAGATTAGACCATCAATGTTAGAAATCTTTTCAAGGGCAATGTTTACTCCTTTTTCAGTTTCTTGTGGTATCCTCAGAAGAATCACCTGGCAGGCATCGTTAAGCAAAGGCAGAACACTGGCAAATATTAATACAGAAATGAATAGTGAGCATAAGGGGTCTGCAATGAGCCAGCCGAACTGTCGAATCAGGATGGTGGATACAATGACTCCAACGCTTCCNAGCGTATCTGCCAATACATGTAAGAATACACCTCTCATATTTGCATTCATCCCAACTCCAGCAGACCCATGAGAGTGTCCATGATTGTGGGTATGTCCATGGTTTATGGCATGTCCATGGTCACTATGTAAGTGGTTGTGCCCTTGACTGTGTCCATGGTGAGAATGGCCATAATCAAAAAAAGAACACCCTCCTCCAAAAACCCCCCAGGGAAAAGGGGCATGGGTTAAAAACAAAAAAAACCCAACAAAGGTTTATCCAAAAC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACATGATATAAGTCCCATCCTTGT