ORFeome > slc35a3.2 ORF1 – XORFeome v1.0

slc35a3.2 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: slc35a3.2
Gene ID: 5757952
Gene Page ID: 5757898
ORF Xenbase ID: 17297103

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC053795
Original XGC clone length: 684

Human orthology & disease relationships

NCBI Entrez ID: 23443
Ensembl gene IDs: ENSG00000117620
Directly associated (OMIM) disease MIM numbers: 615553
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11003
Well Location: E04

Sequences - 5ʹ (forward) EST

Accession: JZ839483
dbEST ID: 79657185
Trimmed Sequence: ATGGCGTCCCACCTGAAGTACATATCACTGGGGGTGCTGGTATTCCAGACCACAACTTTAGTACTAACAATGCGCTACTCCCGCACGCTGAAGGAAGAGGGGCCACGCTACTTGTCCTCCACAGCTGTAGTAGCAGCAGAGGTGCTGAAGATTGTGGCCTGTATTGTGCTAGTCTATAAAGAAAATAGTTACAGCGTTAGATCTTTGAGGAGAGTGCTGCACGATGAGATAATCAACAAGCCGATGGAGACCCTGAAGCTGGCCATACCTTCCGGCATTTACACCCTACAGAATAATCTCCTCTATGTAGCACTGTCCAACCTTGATGCAGCCACTTATCAGGTGACCTATCAGCTCAAAATCCTCACCACAGCGTTGTTCTCGGTGTCCATGCTTCAGAGGCAACTGACAAAGTACCAGTGGATTTCATTGCTTATCCTGATGTCTGGAGTTGCATTAGTTCAGTGGCCGGACGATTCTTCGACTGCCCCTAGCAAAGAGGTTTCCGTGGGCTCTGGGTTTGTGGGCCTCATGGCCGTCTTCACCGCTTGCTTTTCCAGTGGCTTTGCCGGAGTCTATTTTGAAAAGATTCTTAAAGAAACAAAGCAGTCAGTGTGGATACGGAATATACAGCTGGGGTTTTTTTGGATGGATATTTGGCCTAATGGGAGTTTTCATTTTATGGCCAC
Full Trace Sequence: CCGGGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGTCCCACCTGAAGTACATATCACTGGGGGTGCTGGTATTCCAGACCACAACTTTAGTACTAACAATGCGCTACTCCCGCACGCTGAAGGAAGAGGGGCCACGCTACTTGTCCTCCACAGCTGTAGTAGCAGCAGAGGTGCTGAAGATTGTGGCCTGTATTGTGCTAGTCTATAAAGAAAATAGTTACAGCGTTAGATCTTTGAGGAGAGTGCTGCACGATGAGATAATCAACAAGCCGATGGAGACCCTGAAGCTGGCCATACCTTCCGGCATTTACACCCTACAGAATAATCTCCTCTATGTAGCACTGTCCAACCTTGATGCAGCCACTTATCAGGTGACCTATCAGCTCAAAATCCTCACCACAGCGTTGTTCTCGGTGTCCATGCTTCAGAGGCAACTGACAAAGTACCAGTGGATTTCATTGCTTATCCTGATGTCTGGAGTTGCATTAGTTCAGTGGCCGGACGATTCTTCGACTGCCCCTAGCAAAGAGGTTTCCGTGGGCTCTGGGTTTGTGGGCCTCATGGCCGTCTTCACCGCTTGCTTTTCCAGTGGCTTTGCCGGAGTCTATTTTGAAAAGATTCTTAAAGAAACAAAGCAGTCAGTGTGGATACGGAATATACAGCTGGGGTTTTTTTGGATGGATATTTGGCCTAATGGGAGTTTTCATTTTATGGCCACTTTCTTGTACCAATTTGGCATTATAAGAAAGCATTGGCTAACAATTTGTTGCAACCAAAAGGGTCACTATCAGTCCAAATTAAAATCATTTATTTGGCCATCCCCCCTGAAAAACCACAAAAAAAAAAAAAAC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGTCCCACCTGAA

Sequences - 3ʹ (reverse) EST

Accession: JZ839482
dbEST ID: 79657184
Trimmed Sequence: TAAATGAAAACTCCCATTAGGCCAAATATCCATCCAAAAAAACCCCAGCTGTATATTCCGTATCCACACTGACTGCTTTGTTTCTTTAAGAATCTTTTCAAAATAGACTCCGGCAAAGCCACTGGAAAAGCAAGCGGTGAAGACGGCCATGAGGCCCACAAACCCAGAGCCCACGGAAACCTCTTTGCTAGGGGCAGTCGAAGAATCGTCCGGCCACTGAACTAATGCAACTCCAGACATCAGGATAAGCAATGAAATCCACTGGTACTTTGTCAGTTGCCTCTGAAGCATGGACACCGAGAACAACGCTGTGGTGAGGATTTTGAGCTGATAGGTCACCTGATAAGTGGCTGCATCAAGGTTGGACAGTGCTACATAGAGGAGATTATTCTGTAGGGTGTAAATGCCGGAAGGTATGGCCAGCTTCAGGGTCTCCATCGGCTTGTTGATTATCTCATCGTGCAGCACTCTCCTCANAGATCTAACGCTGTAACTATTTTCTTTATAGACTAGCACAATACAGGCCACAATCTTCAGCACCTCTGCTGCTACTACAGCTGTGGAGGACAAGTAGCGTGCCCCCTCTTCCTTCAGCGTGCGGGAGTAGCGCATTGTTAGTACTAAAGTTGTGGTCCTGGAATACAGCACCCTCCTTGATATGAACTTCAGGGGGGAAGCCCGGGGGCCCACCTTTTTTGTACAAAATTGGGCTTTATAAAAAACCTTTGCTCATTCAATTTTTTTTGGAACCCAAAAAAGGTT
Full Trace Sequence: GAAAAGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATAAATGAAAACTCCCATTAGGCCAAATATCCATCCAAAAAAACCCCAGCTGTATATTCCGTATCCACACTGACTGCTTTGTTTCTTTAAGAATCTTTTCAAAATAGACTCCGGCAAAGCCACTGGAAAAGCAAGCGGTGAAGACGGCCATGAGGCCCACAAACCCAGAGCCCACGGAAACCTCTTTGCTAGGGGCAGTCGAAGAATCGTCCGGCCACTGAACTAATGCAACTCCAGACATCAGGATAAGCAATGAAATCCACTGGTACTTTGTCAGTTGCCTCTGAAGCATGGACACCGAGAACAACGCTGTGGTGAGGATTTTGAGCTGATAGGTCACCTGATAAGTGGCTGCATCAAGGTTGGACAGTGCTACATAGAGGAGATTATTCTGTAGGGTGTAAATGCCGGAAGGTATGGCCAGCTTCAGGGTCTCCATCGGCTTGTTGATTATCTCATCGTGCAGCACTCTCCTCANAGATCTAACGCTGTAACTATTTTCTTTATAGACTAGCACAATACAGGCCACAATCTTCAGCACCTCTGCTGCTACTACAGCTGTGGAGGACAAGTAGCGTGCCCCCTCTTCCTTCAGCGTGCGGGAGTAGCGCATTGTTAGTACTAAAGTTGTGGTCCTGGAATACAGCACCCTCCTTGATATGAACTTCAGGGGGGAAGCCCGGGGGCCCACCTTTTTTGTACAAAATTGGGCTTTATAAAAAACCTTTGCTCATTCAATTTTTTTTGGAACCCAAAAAAGGTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATAAATGAAAACTCCCATTAGGCCA