ORFeome > slc35b2 ORF1 – XORFeome v1.0

slc35b2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: slc35b2
Gene ID: 1009917
Gene Page ID: 1009912
ORF Xenbase ID: 17297115

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC044702
Original XGC clone length: 1320

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11015
Well Location: E06

Sequences - 5ʹ (forward) EST

Accession: JZ824222
dbEST ID: 79641924
Trimmed Sequence: ATGGGGTGTCCCGACCGGACCGACTGCAGGTACCTGCTGCTTCTCTCTCTGGTCTCTGTCTCGGGAGTATGTGCTGATGAGCCTCCCCCTGAACTGCCCCCTCAAGACTCTTGGGGAGATCTGTGGCTGGTGCGTTTTTTCATGAATATTGCAGGTTATGGGACCATCCTCCTGCCAGGATACCTTCTCATTCGCTACTTCAAACACAAAAACTACCTAGAGACTGGTAGAGGCCTCTGTTACCCTGTGGTGAAGTCTTGTGTTTTTGGCCATGAGTCCAAGTCTTTGTCCCCTGAAGAAACGGCTGCAGCCCCCAGGGTTGAGGGTGACCCTTCCAATACTCAACAGGCCCTCAAGCTTCTCTTCTGCACAGCTGGACTCCAGGTCTCCTATCTGACATGGGGAGTTCTACAGGAACGTGTAATGACCCGCACATACGGCTCAGAGGAAGGAGGCCCCGGGGAACGTTTCCGTGACTCACAGTTTCTCGTCTTCATGAACCGCATCCTGGCTCTGACGGTGGCCGGCCTATACTGCAGCGTGACCAAGCAGCCGCGCCATGGTGCCCCCATGTACAAATATTCCTTTGCCTCCCTCTCTAATATCCTGAGCAGCTGGTGCCAGTATGAAGCCCTCAAGTTCATCAGCTTCCCCACCCAGGTACTTGCCAAGGCATCCAAGGTCATCCCAGTCATGCTAATGGGCAAACTGGTGTCGCATAAGAGCTACGAGTACTGGGAGTACCTGACTGCTGTGCTTATCTCTGGTGGGGGTCAGCATGTTTCTGTTGTCTAAACGGAAAAGGGCCACCCGCCCCTTTCGGG
Full Trace Sequence: CAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGGTGTCCCGACCGGACCGACTGCAGGTACCTGCTGCTTCTCTCTCTGGTCTCTGTCTCGGGAGTATGTGCTGATGAGCCTCCCCCTGAACTGCCCCCTCAAGACTCTTGGGGAGATCTGTGGCTGGTGCGTTTTTTCATGAATATTGCAGGTTATGGGACCATCCTCCTGCCAGGATACCTTCTCATTCGCTACTTCAAACACAAAAACTACCTAGAGACTGGTAGAGGCCTCTGTTACCCTGTGGTGAAGTCTTGTGTTTTTGGCCATGAGTCCAAGTCTTTGTCCCCTGAAGAAACGGCTGCAGCCCCCAGGGTTGAGGGTGACCCTTCCAATACTCAACAGGCCCTCAAGCTTCTCTTCTGCACAGCTGGACTCCAGGTCTCCTATCTGACATGGGGAGTTCTACAGGAACGTGTAATGACCCGCACATACGGCTCAGAGGAAGGAGGCCCCGGGGAACGTTTCCGTGACTCACAGTTTCTCGTCTTCATGAACCGCATCCTGGCTCTGACGGTGGCCGGCCTATACTGCAGCGTGACCAAGCAGCCGCGCCATGGTGCCCCCATGTACAAATATTCCTTTGCCTCCCTCTCTAATATCCTGAGCAGCTGGTGCCAGTATGAAGCCCTCAAGTTCATCAGCTTCCCCACCCAGGTACTTGCCAAGGCATCCAAGGTCATCCCAGTCATGCTAATGGGCAAACTGGTGTCGCATAAGAGCTACGAGTACTGGGAGTACCTGACTGCTGTGCTTATCTCTGGTGGGGGTCAGCATGTTTCTGTTGTCTAAACGGAAAAGGGCCACCCGCCCCTTTCGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGGTGTCCCGACCG

Sequences - 3ʹ (reverse) EST

Accession: JZ829537
dbEST ID: 79647239
Trimmed Sequence: CACCTTCTGCACCACTGGGATATCCGCAGCCTTTCTACCCTTCTTCCTCATCCTCCCCCTGGCATAGACCCGGAGAAAAAGGGCAAGGAAGACAGTAGCCACCCCGACTCCTCCCACTGCGGTAACAGGATGCCCATAGAGCAGACAGGACAGCAAGATAGCTAGTGCCTGGCGCAAAGTCATGATAATGGTGAAGACGGCAGCTCCGAACTTGTTGATGGTGTAAAAGATAAAGAGCTGCCCAAAAGCCGAGCAGACGGAGAGGAGACAAGCATGAAAGGCAAAATCGGGGTGTCTTGTCATGAAGTGAATGGCCTCCAGCATGGCCCCCTGCTCCAGGAGAGAGCCCACCGTGAAGAGGCAGGAGAACATGTTAACCCCAAACATCATCTGCACAGAGGACATTTTGTACTTGAAGAGCGAGTCCTGCCAGTTGGAAGTGAAGCTGTCAAACACAATATAGCCAGCCAGAATGACCAGCCCGGAGAAGGTGGTGACCCCCGAAGGGCGGTTGCCCTCTCCGTTAGACAACAGAAACATGCTGACCCCAACAGAGATAAGCACAGCAGTCAGGTACTCCCAGTACTCGTAGCTCTTATGCGACACCAGTTTGCCCATTAGCATGACTGGGATGACCTTGGATGCCTTGGGCAAGTACCTTGGGTGGGGGAAGCTGATGAAACTTGAGGGCTTTCATACTGGGCACCCAGCCTGCCTCA
Full Trace Sequence: TGGCGTGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACACCTTCTGCACCACTGGGATATCCGCAGCCTTTCTACCCTTCTTCCTCATCCTCCCCCTGGCATAGACCCGGAGAAAAAGGGCAAGGAAGACAGTAGCCACCCCGACTCCTCCCACTGCGGTAACAGGATGCCCATAGAGCAGACAGGACAGCAAGATAGCTAGTGCCTGGCGCAAAGTCATGATAATGGTGAAGACGGCAGCTCCGAACTTGTTGATGGTGTAAAAGATAAAGAGCTGCCCAAAAGCCGAGCAGACGGAGAGGAGACAAGCATGAAAGGCAAAATCGGGGTGTCTTGTCATGAAGTGAATGGCCTCCAGCATGGCCCCCTGCTCCAGGAGAGAGCCCACCGTGAAGAGGCAGGAGAACATGTTAACCCCAAACATCATCTGCACAGAGGACATTTTGTACTTGAAGAGCGAGTCCTGCCAGTTGGAAGTGAAGCTGTCAAACACAATATAGCCAGCCAGAATGACCAGCCCGGAGAAGGTGGTGACCCCCGAAGGGCGGTTGCCCTCTCCGTTAGACAACAGAAACATGCTGACCCCAACAGAGATAAGCACAGCAGTCAGGTACTCCCAGTACTCGTAGCTCTTATGCGACACCAGTTTGCCCATTAGCATGACTGGGATGACCTTGGATGCCTTGGGCAAGTACCTTGGGTGGGGGAAGCTGATGAAACTTGAGGGCTTTCATACTGGGCACCCAGCCTGCCTCA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACACCTTCTGCACCACTGGGAT