ORFeome > slc37a1 ORF1 – XORFeome v1.0

slc37a1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: slc37a1
Gene ID: 5761877
Gene Page ID: 5761875
ORF Xenbase ID: 17297151

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC043786
Original XGC clone length: 1581

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11011
Well Location: D05

Sequences - 5ʹ (forward) EST

Accession: JZ823946
dbEST ID: 79641648
Trimmed Sequence: ATGGCTGCGTTGCCCCCGGGGATCCGTCTCTTCGTGTCCCTGTCCCGGGATCAGTGGTTTCGGGCTCTGGTTCTGGTTCTGACCTTTCTGTTTTACTGCAGCTTTCATCTGTCCCGAAAACCAATCACAATAGTGAAGGGGGAGCTGCACAGACATTGCTCAGAGCCACACGAGGTTGAGCTCCACAGTTACAAGGAGTTTGTGATTCACAATCAGGGGCCCCTTTACTCAGAGCAGAATGCGTCTCGCTGCGGCTGGGCCCCATTTGATAAAAAGAATTATAAGCAGCTCCTGGGGGCTCTGGACTATTCCTTCCTCTGCGCCTATGCCATTGGCATGTTCCTCAGTGGGATGATCGGGGAGCGCTTGCCTCTCAGGTATTTCCTCTCCTGCGGGATGTTGGCCAGTGGCTTATTTACTGCCCTATTTGGCTTTGGATATTTCTACAATATTCACAACCTGTCCTACTACATCATCATACAGGTACTGAATGGTTTGGTTCAGACCACCGGTTGGCCGAGCGTAGTCACCTGCATTGGAAACTGGTTTGGGAAAGGAAAGAGAGGCCTCATCATGGGAGTGTGGAACTCACACACATCAGTGGGCAACATCCTGGGCTCTCTTATTGCTGGATACTGGGTGTCAAACTGCTGGGGGATGTCCTTCTTGNNTGCCGGAATGATCATCTCCTTCATGGGCATCATCTGCTTCCTCTTCCTTGTAGAGCATCCCCAGGGATATCAAGTCTGAGGGCACACCCAGCCCCCTCAAGGTTGCAAGGGATATAAAAGTCCCGAAAAAATTTACTACCGAAATAACAAAGGGTCCCGGGAACAACAAG
Full Trace Sequence: CCAGTAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTGCGTTGCCCCCGGGGATCCGTCTCTTCGTGTCCCTGTCCCGGGATCAGTGGTTTCGGGCTCTGGTTCTGGTTCTGACCTTTCTGTTTTACTGCAGCTTTCATCTGTCCCGAAAACCAATCACAATAGTGAAGGGGGAGCTGCACAGACATTGCTCAGAGCCACACGAGGTTGAGCTCCACAGTTACAAGGAGTTTGTGATTCACAATCAGGGGCCCCTTTACTCAGAGCAGAATGCGTCTCGCTGCGGCTGGGCCCCATTTGATAAAAAGAATTATAAGCAGCTCCTGGGGGCTCTGGACTATTCCTTCCTCTGCGCCTATGCCATTGGCATGTTCCTCAGTGGGATGATCGGGGAGCGCTTGCCTCTCAGGTATTTCCTCTCCTGCGGGATGTTGGCCAGTGGCTTATTTACTGCCCTATTTGGCTTTGGATATTTCTACAATATTCACAACCTGTCCTACTACATCATCATACAGGTACTGAATGGTTTGGTTCAGACCACCGGTTGGCCGAGCGTAGTCACCTGCATTGGAAACTGGTTTGGGAAAGGAAAGAGAGGCCTCATCATGGGAGTGTGGAACTCACACACATCAGTGGGCAACATCCTGGGCTCTCTTATTGCTGGATACTGGGTGTCAAACTGCTGGGGGATGTCCTTCTTGNNTGCCGGAATGATCATCTCCTTCATGGGCATCATCTGCTTCCTCTTCCTTGTAGAGCATCCCCAGGGATATCAAGTCTGAGGGCACACCCAGCCCCCTCAAGGTTGCAAGGGATATAAAAGTCCCGAAAAAATTTACTACCGAAATAACAAAGGGTCCCGGGAACAACAAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTGCGTTGCCCCC

Sequences - 3ʹ (reverse) EST

Accession: JZ829254
dbEST ID: 79646956
Trimmed Sequence: GTGCTCTTTATATTCTGTAATCTCTTGTACGTTTGGCCGGCGGCAGCTGAGTTCCTTCCTTATGAGCCGCAACAGAAACAGGAGGGCAAGAGCATCACTCAGCATGAGCATAAAGAACACATTGTCCCATCCATACGGGGACAGGAGTCCAGCGAGCAGTGGCCCCAGAGCAGCACCCACAGACCCAGTCCCATCAATGATGGCAGTGACAGTAGACAGAGCATGAGCGTTGCCTTTCAGAGATTTGTGGGTCCCCAGATCAGCAGACACAGCCGTTGTAATGAGAGAGTAAGGGCCATTCACCAGGGCCCCACAGACCAGCAGCATTCCAACAGTGAAACCTGCCCCCATGTTACTGACCGACGAGAAGAAATACAATGTGGGGGCTGAACAGAGTAACATGAATCCACAGGTGGTGGCACGCTTCTGAGCTTTATCAGATATGACCCCAGCCACAATTCCACCAATAATTCCCCCAACATCAAACAGTGTGGAAAGGTCCCCAGCACGCCGGACATCCATGTGACCCACATTTTTGATGTAAAGGGGCAACCAGAAAAGGAACGTGTAACTGACCAGTTTAGCAAAAAGCAAACACATGGAGAATTCCCCTACCCCCGGGAATTTGAAAACCCCCAGGAAACTGATGGGCGCAAATCCTTTTCCTGGAATTTTGGATTTCTTTCTGTTAGGACAATGA
Full Trace Sequence: CTGGCAGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTGCTCTTTATATTCTGTAATCTCTTGTACGTTTGGCCGGCGGCAGCTGAGTTCCTTCCTTATGAGCCGCAACAGAAACAGGAGGGCAAGAGCATCACTCAGCATGAGCATAAAGAACACATTGTCCCATCCATACGGGGACAGGAGTCCAGCGAGCAGTGGCCCCAGAGCAGCACCCACAGACCCAGTCCCATCAATGATGGCAGTGACAGTAGACAGAGCATGAGCGTTGCCTTTCAGAGATTTGTGGGTCCCCAGATCAGCAGACACAGCCGTTGTAATGAGAGAGTAAGGGCCATTCACCAGGGCCCCACAGACCAGCAGCATTCCAACAGTGAAACCTGCCCCCATGTTACTGACCGACGAGAAGAAATACAATGTGGGGGCTGAACAGAGTAACATGAATCCACAGGTGGTGGCACGCTTCTGAGCTTTATCAGATATGACCCCAGCCACAATTCCACCAATAATTCCCCCAACATCAAACAGTGTGGAAAGGTCCCCAGCACGCCGGACATCCATGTGACCCACATTTTTGATGTAAAGGGGCAACCAGAAAAGGAACGTGTAACTGACCAGTTTAGCAAAAAGCAAACACATGGAGAATTCCCCTACCCCCGGGAATTTGAAAACCCCCAGGAAACTGATGGGCGCAAATCCTTTTCCTGGAATTTTGGATTTCTTTCTGTTAGGACAATGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTGCTCTTTATATTCTGTAATCTC