ORFeome > slc39a7 ORF1 – XORFeome v1.0

slc39a7 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: slc39a7
Gene ID: 866218
Gene Page ID: 492962
ORF Xenbase ID: 17297205

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC124938
Original XGC clone length: 1401

Human orthology & disease relationships

NCBI Entrez ID: 7922
Ensembl gene IDs: ENSG00000112473
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 116920,226730,273800

Library Location

Plate ID: GDExl11082
Well Location: G07

Sequences - 5ʹ (forward) EST

Accession: JZ837255
dbEST ID: 79654957
Trimmed Sequence: ATGGGTCGACTTTGGTTGAAAAGTGGTGTTGGTTGTGCCTTATTGGTAGCTATCTTCATGTTCTGTTGTTTGGTGCACACAGCCTTATCCCAGGCACATGAGGATTTTCATCATGGTCATAGCCATGCACATCATGGGCACAGCCATGGTCACCATGGACATGGCCACAGTCATCACGGACATGATTGTCATGGACACGGGCATTCCCATCATGGACATAGTCATGAGGATCTAAACCATGGTCATAGCCATGTGCATCATGGGCACAGCCATCAAGATCACCATGGGCACAGCCATGAGGAAATCCAGCATGAGCATAGTCCAGATCATAAAGAGCAGAGCCATGTAGTAGAAGAGCGCACCAAAAGAGAAGCACCAACTGGAGATAATTTAATACACAATCATGGGTCAAAAGAGAAAATGGAACCTGTGCAACTTTGGACATATGCTATATGTGCCACACTCCTGATATCAGCTGCTCCCTTCTTCATCCTCTTCCTGATACCTGTGCAGTCTAATAGCAGCCAGCACCAGTCCCTGCTCAAATTACTCCTGAGCTTTGCATCAGGGGGGCTTCTTGGAGATGCCTTTTTGCACCTCATCCCTCATGCACTAGAGCCACATTCTGTACATGAAGCAGTTGCAGAGCCTGAAAAAAACACATGGCCACGGACACTCTCATGGTCAAACCACCCCCAGATGAATGTAATTTGCCCTTTGGTTCCTTTCCTGAATTATTGCCCTTTCTTTTTGTTTAAAAAATTTCGTGAAGGCATTTTTAAAAGGAAAAACCTTGAAACGGGGGTTCCCCA
Full Trace Sequence: CGGGGCCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGTCGACTTTGGTTGAAAAGTGGTGTTGGTTGTGCCTTATTGGTAGCTATCTTCATGTTCTGTTGTTTGGTGCACACAGCCTTATCCCAGGCACATGAGGATTTTCATCATGGTCATAGCCATGCACATCATGGGCACAGCCATGGTCACCATGGACATGGCCACAGTCATCACGGACATGATTGTCATGGACACGGGCATTCCCATCATGGACATAGTCATGAGGATCTAAACCATGGTCATAGCCATGTGCATCATGGGCACAGCCATCAAGATCACCATGGGCACAGCCATGAGGAAATCCAGCATGAGCATAGTCCAGATCATAAAGAGCAGAGCCATGTAGTAGAAGAGCGCACCAAAAGAGAAGCACCAACTGGAGATAATTTAATACACAATCATGGGTCAAAAGAGAAAATGGAACCTGTGCAACTTTGGACATATGCTATATGTGCCACACTCCTGATATCAGCTGCTCCCTTCTTCATCCTCTTCCTGATACCTGTGCAGTCTAATAGCAGCCAGCACCAGTCCCTGCTCAAATTACTCCTGAGCTTTGCATCAGGGGGGCTTCTTGGAGATGCCTTTTTGCACCTCATCCCTCATGCACTAGAGCCACATTCTGTACATGAAGCAGTTGCAGAGCCTGAAAAAAACACATGGCCACGGACACTCTCATGGTCAAACCACCCCCAGATGAATGTAATTTGCCCTTTGGTTCCTTTCCTGAATTATTGCCCTTTCTTTTTGTTTAAAAAATTTCGTGAAGGCATTTTTAAAAGGAAAAACCTTGAAACGGGGGTTCCCCA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGTCGACTTTGGTTG

Sequences - 3ʹ (reverse) EST

Accession: JZ837254
dbEST ID: 79654956
Trimmed Sequence: CTCAAACTGTGCAATGAGAACCATCATAGCGACCCCAAGGAGGAGTCCAAAGGTTTCAAGGATGGACTGCAAAGGGCGTGAGTCCTTCAGGAGTTCTGGGATAACTGAAACTGTTGCAATATAAATAAATCCCCCTGCTGTGAATGGCAGAATCCATAAGGTTGCGGCTTCCCCAATTCCTTCTGCCAAGAGAGAGCAAATGGTGCCTGCAAGTGCTCCCAAAGCTGTACTGAGCTGTAGCATCATTGCCTTCCTCTTTGTGCATCCACTCTGCACCAGGATAGCAAAGTCCCCAATTTCATGAGGCACTTCATGTAGGAGAATTGTGATTGTGGTGACAATTCCAACACTGCTGCTGACCAGGAACGAGGCTCCCATTGCTAGACCATCAGTGAAGTTGTGTGTGAGATCAGCAGCAAGATTTAAATAGCCGGACACGGTCATTTCTGATTGTAGTGGTTCCTTATTGCCGTTTTTGCCTTTCTGCACAGTGCTACTTCCTTTCTTTCTTTTTCTCACGCCATCCGGTGGTGGGTTTGGTGCCCTCTCTTTTTCTCTTGCATCATCGACTATTATTTTCTTTTCAGCATGGAGGGGTCGGGGGGCGAGGGCGTATTCTCCGGTGCAATGCCTTCAGGAGGGTCGTAAGAGACAAAAAAAGAAATAGATTCGGGTAGGGAACCCGGAAGGGCAAGCTAAGGTGATCCTGTAATTT
Full Trace Sequence: AAAACGGCTATGGACGCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTCAAACTGTGCAATGAGAACCATCATAGCGACCCCAAGGAGGAGTCCAAAGGTTTCAAGGATGGACTGCAAAGGGCGTGAGTCCTTCAGGAGTTCTGGGATAACTGAAACTGTTGCAATATAAATAAATCCCCCTGCTGTGAATGGCAGAATCCATAAGGTTGCGGCTTCCCCAATTCCTTCTGCCAAGAGAGAGCAAATGGTGCCTGCAAGTGCTCCCAAAGCTGTACTGAGCTGTAGCATCATTGCCTTCCTCTTTGTGCATCCACTCTGCACCAGGATAGCAAAGTCCCCAATTTCATGAGGCACTTCATGTAGGAGAATTGTGATTGTGGTGACAATTCCAACACTGCTGCTGACCAGGAACGAGGCTCCCATTGCTAGACCATCAGTGAAGTTGTGTGTGAGATCAGCAGCAAGATTTAAATAGCCGGACACGGTCATTTCTGATTGTAGTGGTTCCTTATTGCCGTTTTTGCCTTTCTGCACAGTGCTACTTCCTTTCTTTCTTTTTCTCACGCCATCCGGTGGTGGGTTTGGTGCCCTCTCTTTTTCTCTTGCATCATCGACTATTATTTTCTTTTCAGCATGGAGGGGTCGGGGGGCGAGGGCGTATTCTCCGGTGCAATGCCTTCAGGAGGGTCGTAAGAGACAAAAAAAGAAATAGATTCGGGTAGGGAACCCGGAAGGGCAAGCTAAGGTGATCCTGTAATTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTCAAACTGTGCAATGAGAACC