ORFeome > slc3a2 ORF1 – XORFeome v1.0

slc3a2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: slc3a2
Gene ID: 1009249
Gene Page ID: 1009244
ORF Xenbase ID: 17297229

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC042294
Original XGC clone length: 1617

Human orthology & disease relationships

NCBI Entrez ID: 6520
Ensembl gene IDs: ENSG00000168003
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 131760,131800,131900,131960,135300,174050,176200,179850,181000,209300,308240,608957,608971,609040,609352

Library Location

Plate ID: GDExl11015
Well Location: B06

Sequences - 5ʹ (forward) EST

Accession: JZ824260
dbEST ID: 79641962
Trimmed Sequence: ATGACCCAAGATACTGCCCTAGACATGAAAGATGTTGAACTGAATGAACTGGAACAAGAAAAAGTCCCAATGGCAGATGGGGCCGGGGACAGCCCAACCGGAGGGGGAGAGAAGAATGGAGTTGTTAAGGTGAAGCTTGACGATGATGATGACATGCCAGCCAAAAGTCAGAAATTTACAGGGTTGTCTAAAGAAGAATTACTGCGAGTGGCTGGTACCCCGACATGGGTGAGAGTCCGATGGGCATTGCTGATCCTGTTTTGGTTAGGCTGGGCTGGCATGCTAGCAGGAGCTGTGGTCATCATCGTACAAGCACCTCGTTGCCGGCCTTTGCCAGCAATGGAATGGTGGAACAAGGGACCCCTCTACCAAGTTGGTGATCCAGCAACCTTTCAAGAAGATGGAGCTGGAAATATTCAGAGTATAGAGAAGCGTCTTGAGTCACTTACCAGTCTGAAAGTAAAAGGTTTGATTATTGGTCCAATACATGTCACGAAGAAAGATCATATTGGTGAAACTGAACTCACTGACATTGACCCCAATTATGGCACAATGGAGCAATTCACCAGTTTGCTGGAAGCTGCACGCAAAAAGAGTATTCAGATCATCTTGGACCTTACTCCTAATTACCGCAGTGAAAACAGCTGGTTTGACAAGGCTGACAGGGATAACAATATTTTCTTTGATGAAGTAAAGGATGCAGTTGATGTTTGGCTGGAACATGGCTGTGGAAGGACAATACTTTGGGAGACAGCGAAAAATTTTCCCAATGCCAACCAGTTTTATTTATTGACTGGGGGGAAACATGTACTGGCCATTAACAGGCAAAAAGGGAAA
Full Trace Sequence: AATATTGGATTTTAATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACCCAAGATACTGCCCTAGACATGAAAGATGTTGAACTGAATGAACTGGAACAAGAAAAAGTCCCAATGGCAGATGGGGCCGGGGACAGCCCAACCGGAGGGGGAGAGAAGAATGGAGTTGTTAAGGTGAAGCTTGACGATGATGATGACATGCCAGCCAAAAGTCAGAAATTTACAGGGTTGTCTAAAGAAGAATTACTGCGAGTGGCTGGTACCCCGACATGGGTGAGAGTCCGATGGGCATTGCTGATCCTGTTTTGGTTAGGCTGGGCTGGCATGCTAGCAGGAGCTGTGGTCATCATCGTACAAGCACCTCGTTGCCGGCCTTTGCCAGCAATGGAATGGTGGAACAAGGGACCCCTCTACCAAGTTGGTGATCCAGCAACCTTTCAAGAAGATGGAGCTGGAAATATTCAGAGTATAGAGAAGCGTCTTGAGTCACTTACCAGTCTGAAAGTAAAAGGTTTGATTATTGGTCCAATACATGTCACGAAGAAAGATCATATTGGTGAAACTGAACTCACTGACATTGACCCCAATTATGGCACAATGGAGCAATTCACCAGTTTGCTGGAAGCTGCACGCAAAAAGAGTATTCAGATCATCTTGGACCTTACTCCTAATTACCGCAGTGAAAACAGCTGGTTTGACAAGGCTGACAGGGATAACAATATTTTCTTTGATGAAGTAAAGGATGCAGTTGATGTTTGGCTGGAACATGGCTGTGGAAGGACAATACTTTGGGAGACAGCGAAAAATTTTCCCAATGCCAACCAGTTTTATTTATTGACTGGGGGGAAACATGTACTGGCCATTAACAGGCAAAAAGGGAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACCCAAGATACTGCC

Sequences - 3ʹ (reverse) EST

Accession: JZ829587
dbEST ID: 79647289
Trimmed Sequence: TCCACTATAAGGGTATTTAAGGAGTAAAGCCTCTCCGGCTCCTAACTTGAAGCTTTTTAGGGAAACCGTTTCCCCATCTTTTCGTTGTGGGTTGGAACTCAACACCACTGTGCCCTGCTCTGGCAGCTCTTCTCCTCCATCTTTTTTCAGGAAGAGTTCTACTTCCCCCTCGTAGTTAAAGTTCAAAGCTGTCACATATCGCTCATTCTGGTCCCAGCTTCTTAGGAAAGATATGGCCTCTTCACTGTTATACAGTAGTGTAAATTCACCATGCAGGAGGGATCGTTCTTTCCCCCTCAAGTCACTCAACTTCCTGTACACGTTTAGGAAGGAACCCTTGTCAGCATCCTGTGCCTTAAATGTGATATTTGCATTTACATCAGATGCAATTTGAGGAGAATTATTGGACACTGAAACTTCTTCCCACTGCATGTTAGGTCTTGAGGACTGAGCAGGCTGTCCAGGAAGGTCTTTAAGTCCAATTTCATCCCCATATAAAGATATTGGGGTGCCTGGCAGTGTGAAGAGGAGGAGTTGGTACACACGAAGTAGCTTCTCGTTGACCAAAGAAGCCATATGACGCACTTGTGGTGCTCCAATCATCCAACTGTTTCCCTGGATGCCAGTCTCTTCCACATATTGTTTTATGCTTTCACCCAAAGAACCAAAGCTTTTTCTTGTTTTTCAGCAACCCAGGAAGCGGTTAAAAGAAACGTGCCCATCCTTATTGTTCCCCATTTAAAACC
Full Trace Sequence: TGGCGTGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATCCACTATAAGGGTATTTAAGGAGTAAAGCCTCTCCGGCTCCTAACTTGAAGCTTTTTAGGGAAACCGTTTCCCCATCTTTTCGTTGTGGGTTGGAACTCAACACCACTGTGCCCTGCTCTGGCAGCTCTTCTCCTCCATCTTTTTTCAGGAAGAGTTCTACTTCCCCCTCGTAGTTAAAGTTCAAAGCTGTCACATATCGCTCATTCTGGTCCCAGCTTCTTAGGAAAGATATGGCCTCTTCACTGTTATACAGTAGTGTAAATTCACCATGCAGGAGGGATCGTTCTTTCCCCCTCAAGTCACTCAACTTCCTGTACACGTTTAGGAAGGAACCCTTGTCAGCATCCTGTGCCTTAAATGTGATATTTGCATTTACATCAGATGCAATTTGAGGAGAATTATTGGACACTGAAACTTCTTCCCACTGCATGTTAGGTCTTGAGGACTGAGCAGGCTGTCCAGGAAGGTCTTTAAGTCCAATTTCATCCCCATATAAAGATATTGGGGTGCCTGGCAGTGTGAAGAGGAGGAGTTGGTACACACGAAGTAGCTTCTCGTTGACCAAAGAAGCCATATGACGCACTTGTGGTGCTCCAATCATCCAACTGTTTCCCTGGATGCCAGTCTCTTCCACATATTGTTTTATGCTTTCACCCAAAGAACCAAAGCTTTTTCTTGTTTTTCAGCAACCCAGGAAGCGGTTAAAAGAAACGTGCCCATCCTTATTGTTCCCCATTTAAAACC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATCCACTATAAGGGTATTTAAGGAG