ORFeome > slc43a1 ORF1 – XORFeome v1.0

slc43a1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: slc43a1
Gene ID: 6253599
Gene Page ID: 5721377
ORF Xenbase ID: 17297259

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC081238
Original XGC clone length: 1662

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11003
Well Location: H11

Sequences - 5ʹ (forward) EST

Accession: JZ839741
dbEST ID: 79657443
Trimmed Sequence: ATGGCACCCTCCCTGGAGACCACATATTCACGCCGTTGGTGGATAGCGTGCACAGCAGTTCTGGAAAACCTTTTCTTTTCTGCTGTTCTTTTTGGATGGGGGTCTCTGCTCATTATGTTACAGCAGGAAGGGACACTGCATT
Full Trace Sequence: GGGTCGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCACCCTCCCTGGAGACCACATATTCACGCCGTTGGTGGATAGCGTGCACAGCAGTTCTGGAAAACCTTTTCTTTTCTGCTGTTCTTTTTGGATGGGGGTCTCTGCTCATTATGTTACAGCAGGAAGGGACACTGCATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCGGGCGATATCCCCGATAGTGAGTCGGTATTACATGGGCATAGCGGTTTCCTGGCGACTCTGGCCCGTGTCATTAAACAAGATAAGATAAAACAAAGGACGGGACTGCAATGCATCAGCAGGACTGAACGGACCTCCCTAGAACGGAACTTGCGGGGTGTCGGTGCTAGGGGAGGTTGCCAAGGGACGAACCCCGGGGCAACAGCCGGTGGGTTGAAACCATTGAATGTAAGCCCGTTGGGGTCACAAGCTGGGTCGCAAAAACTTGTATGGACCCACGCTGGTAGGTCCACAACCGTGGCCTAAACGCGGCGGTGGTAATGTTGCTTTGGCGGGGTTATCATGGCTTGGGGAGACCGCCATAATAGCGTAACCTTGGTGGCTTAGGGATATCTATAAAAAAACACCATTTAAACCTTGGGACAAAATTAAAAAAAAAAAAGGAAAAAAAAATAAAGGGAAAAAAAAAAGGGGACCGGCGCCACCCTATAAAACAAAAAAAAAAAAATAAAAAGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCACCCTCCCTGGAGAC

Sequences - 3ʹ (reverse) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: GGCAGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGCAGTGTCCCTTCCTGCTGTAACATAATGATCATATACCCCCATCCNAAAAAAAGATCAAAAAACAAAAGGTTTTCCATGAACTGCTGTGCACGCTATCCACCAACAGCATGAATATGTGGTCTCCAGGGAGGATGCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGACCTTAATACTGGCCGTCGTTTATAAACATCATGACAAAATAAATAAAAAGTATGCCCTGCACCGGACCACAACAAACGTGAAGAACACCGGAATACTCGACGTTACGTTTTGACTGATTGAGGTTCATGAGATGACTGCAGAATGGCACTGAACCGCAGGAGAGCTCATCTTGATCAGTTTAAATGCACGTCCGGAAAGGTCATCCGCAACGTGGTCAAAAATCTTGTACGACGCAGCGGTGGAAAAGGCGCAGGTGGCGGTTTCATGGCTTGGTTAGAATGTTTTTTTAGGGTAAAGTTTTTAGGCTTCGGCCTCCAGAGCGTCACGCGCGTACCCCGTTGGTTCAATGTTGGTAGTTATGAGATCTGACAACCAATTTAACCAACCAAGGCAAGCTCCCCCTAAACCAAACCTTAAACCTTATGTAGGGGAAGACGTGGGTTGCGCGAGGAAGATACGCTCCTACCTTCGGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGCAGTGTCCCTTCCTGCC