ORFeome > slc48a1 ORF1 – XORFeome v1.0

slc48a1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: slc48a1
Gene ID: 5804136
Gene Page ID: 5804074
ORF Xenbase ID: 17297307

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC082899
Original XGC clone length: 438

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11004
Well Location: E01

Sequences - 5ʹ (forward) EST

Accession: JZ839679
dbEST ID: 79657381
Trimmed Sequence: ATGGCGGTCACCAGGCAGCTTTGGATCCGTATCATTTACGCGGCGGTGGGCACCTTGTTTGGCCTATCAGCCTTCCTGGTATGGAACGTGGCCTTCGTGCAGCCTTGGACCGCGGCCATGGGAGGGCTATCAGGGGTTCTGGCACTTTGGGCGCTCATCACACACATCATGTACGTGCAAGACTTCTGGAGGACATGGCTGAAAGGACTGCGCTTCTTCCTTTGTATAGGCGTGCTTTTCTTGGTACTGGCGCTGGTAGCCTTCATCACATTCCTTGCAGTAGCCATATCAGAGAAGCAATCCATATCCGACCCAAAGAGCTTATACTTGTCCTGTGTATGGAGCTTCATGTCCATGAAGTGGGCCTTCCTGCTCAGCCTGTACTCCCACCGCTACAGGAAAGAGTTTGCTGACATCAGCATCCTCAGTGACTTCTT
Full Trace Sequence: TCGGGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGTCACCAGGCAGCTTTGGATCCGTATCATTTACGCGGCGGTGGGCACCTTGTTTGGCCTATCAGCCTTCCTGGTATGGAACGTGGCCTTCGTGCAGCCTTGGACCGCGGCCATGGGAGGGCTATCAGGGGTTCTGGCACTTTGGGCGCTCATCACACACATCATGTACGTGCAAGACTTCTGGAGGACATGGCTGAAAGGACTGCGCTTCTTCCTTTGTATAGGCGTGCTTTTCTTGGTACTGGCGCTGGTAGCCTTCATCACATTCCTTGCAGTAGCCATATCAGAGAAGCAATCCATATCCGACCCAAAGAGCTTATACTTGTCCTGTGTATGGAGCTTCATGTCCATGAAGTGGGCCTTCCTGCTCAGCCTGTACTCCCACCGCTACAGGAAAGAGTTTGCTGACATCAGCATCCTCAGTGACTTCTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAACTCAAAAAAAAGTCTCAAATCAAATGAAGTTTAAAAACCACCCCCGCGCCCTCCGGGGGGGGGGGGCCTCCTTTCACCTCCCCCTTGTGGTGTTGGTGGTAAAAAAAAAAAAAATAAAAAAAAAGAAAAAAAAAACGGAAAAACCTGTTTGGGTTATAGCAAGGGGGGGGGGGGGGGGGGGTGCCCCCCCTCCCGCGACCCAAACCCCCACCACCACCCGGGGGGGGGGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGTCACCAGGCAGCTT

Sequences - 3ʹ (reverse) EST

Accession: JZ839678
dbEST ID: 79657380
Trimmed Sequence: GAAGTCACTGAGGATGCTGATGTCAGCAAACTCTTTCCTGTAGCGGTGGGAGTACAGGCTGAGCAGGAAGGCCCACTTCATGGACATGAAGCTCCATACACAGGACAAGTATAAGCTCTTTGGGTCGGATATGGATTGCTTCTCTGATATGGCTACTGCAAGGAATGTGATGAAGGCTACCAGCGCCAGTACCAAGAAAAGCACGCCTATACAAAGGAAGAAGCGCAGTCCTTTCAGCCATGTCCTCCAGAAGTCTTGCACGTACATGATGTGTGTGATGAGCGCCCAAAGTGCCAGAACCCCTGATAGCCCTCCCATGGCCGCGGTCCAAGGCTGCACGAAGGCCACGTTCCATACCANGAAGGCTGATAGGCCAAACAAGGTGCCCACCGCCGCGTAAATGATACGGATCCAAAGCTGCCTGGTGACCGCCATGG
Full Trace Sequence: AAAACTGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGAAGTCACTGAGGATGCTGATGTCAGCAAACTCTTTCCTGTAGCGGTGGGAGTACAGGCTGAGCAGGAAGGCCCACTTCATGGACATGAAGCTCCATACACAGGACAAGTATAAGCTCTTTGGGTCGGATATGGATTGCTTCTCTGATATGGCTACTGCAAGGAATGTGATGAAGGCTACCAGCGCCAGTACCAAGAAAAGCACGCCTATACAAAGGAAGAAGCGCAGTCCTTTCAGCCATGTCCTCCAGAAGTCTTGCACGTACATGATGTGTGTGATGAGCGCCCAAAGTGCCAGAACCCCTGATAGCCCTCCCATGGCCGCGGTCCAAGGCTGCACGAAGGCCACGTTCCATACCANGAAGGCTGATAGGCCAAACAAGGTGCCCACCGCCGCGTAAATGATACGGATCCAAAGCTGCCTGGTGACCGCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCGGCCCGAACTTAAGACTGGACATAAAAAAAAAACACAAAGAACTGGGAAAAAAAAAGGACCCCCAGCCCACCCAAAAAAAAGGGGCTCGCCTCTAAAGCGGCCCGTTGTGTTTTCAGGATGCACACGCGGGGGAGACAAATAGAGAGAAAAAAAACCCCGGGGGAGGCAAGGTTTTTTGGTNGTGGAAAAGAGATGCGCGGGGGGGGGGGGGGGGCCCCCCCCCNC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGAAGTCACTGAGGATGCTGAT