ORFeome > slc7a13 ORF1 – XORFeome v1.0

slc7a13 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: slc7a13
Gene ID: 995918
Gene Page ID: 995916
ORF Xenbase ID: 17297361

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC060020
Original XGC clone length: 1245

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11018
Well Location: D02

Sequences - 5ʹ (forward) EST

Accession: JZ824440
dbEST ID: 79642142
Trimmed Sequence: ATGTGCTCCCTCTGTTACGCTGAACTTGGTTCTGCATTACCTTATGCTGGTGGTGAATATTATCATGTAAAACGAGGACTTGGATCTTTACCTGCCTTCATTTTCATCTGGACATTAATATTGTTCATATTACCTGCGTCCAATGCCGCTCGAGCGCTGACATTTGCCGAATACGCCACTCAGCCATTCTACTCTGGATGCCCCACACCCGAGCTGCTTAAGAAAATAGTGGCACTTGCAGTTCTTTGGGTGTTGGGAATTATAAATATCAAGAGTGCAAAGATGACCACTTGGGTCCAGAATGTTTTTACTGTGCTGAAAATGTTGGCCTTGATCCTTATTGTATTTTGTGGCCTCAGAGAACTTGGAGGAAGAAAAGAGATTCCAGGACACTTAAAGAATGCGTTTAGTTCTCCTGATCCAAATGCAGCTCAAATAGCAGAGTCTTTCTTCCAGAGTCTATATGCATATGGAGGTTGGAGCAGCTTAAATTACATTGCTGAGGACATTAAAAACCCAAGAAAGAACATTCCGCTCTGTACAATAACAGCCGTGTCTGCAGTGATTGTCTTTTATTTGCTGGTAAACATCTCATACCTCACAGTACTGACACCAAAAGAAATAGTTTCTTCAGCTGCTGTATCTGTTACCTGGGCTGTTCGAATTATTCCAGAGGTAGCCTGGATAATACCTGTCTCAGTCGCTATCTCAATATCGGTTCTCTTAATGGNTGATGTGTTTGTGCTTGGACGAATAAACTATGCTGGGGAGCAAGGAAGGGGTCATTTACCTGC
Full Trace Sequence: CATTATTGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTGCTCCCTCTGTTACGCTGAACTTGGTTCTGCATTACCTTATGCTGGTGGTGAATATTATCATGTAAAACGAGGACTTGGATCTTTACCTGCCTTCATTTTCATCTGGACATTAATATTGTTCATATTACCTGCGTCCAATGCCGCTCGAGCGCTGACATTTGCCGAATACGCCACTCAGCCATTCTACTCTGGATGCCCCACACCCGAGCTGCTTAAGAAAATAGTGGCACTTGCAGTTCTTTGGGTGTTGGGAATTATAAATATCAAGAGTGCAAAGATGACCACTTGGGTCCAGAATGTTTTTACTGTGCTGAAAATGTTGGCCTTGATCCTTATTGTATTTTGTGGCCTCAGAGAACTTGGAGGAAGAAAAGAGATTCCAGGACACTTAAAGAATGCGTTTAGTTCTCCTGATCCAAATGCAGCTCAAATAGCAGAGTCTTTCTTCCAGAGTCTATATGCATATGGAGGTTGGAGCAGCTTAAATTACATTGCTGAGGACATTAAAAACCCAAGAAAGAACATTCCGCTCTGTACAATAACAGCCGTGTCTGCAGTGATTGTCTTTTATTTGCTGGTAAACATCTCATACCTCACAGTACTGACACCAAAAGAAATAGTTTCTTCAGCTGCTGTATCTGTTACCTGGGCTGTTCGAATTATTCCAGAGGTAGCCTGGATAATACCTGTCTCAGTCGCTATCTCAATATCGGTTCTCTTAATGGNTGATGTGTTTGTGCTTGGACGAATAAACTATGCTGGGGAGCAAGGAAGGGGTCATTTACCTGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTGCTCCCTCTGTTACGCT

Sequences - 3ʹ (reverse) EST

Accession: JZ829796
dbEST ID: 79647498
Trimmed Sequence: TTGGCTTTTGGGATCTTCAAATATATCTGTGGGAGTCACCTCCAGCAACAGCTGTAAGTAGCAAGTAATGGCATCGAAGTATGGGATACGCAGTTTAAAATAAACAAAAGGGAAATAAATGATCATGCTGCTCAGCATAAACAGTAAGGCATAGAAATATTGCACTTTGGGTGATTGTATTATTGGTGCTAGAACTAAAAATGTGGCGACTAACACAACTCCAAAGGCGATTGGCAGAAAGACCTTATATGGTCTTGGAATGTCTGGTTCTCTGAAGCGTAGAACAATCAGACTTGTAACAGTTAGTCCAATCAAAAGCCAAGAAGAAAAGCCAAAGTAATTAGTTAATGACAGAAGATCTGATGGAATGACGAATACTGATGCAATAATGGTTGAGAGGACTGCAGCCGGAGCCAGAGTCAAGTGATTTACATGAATCATTGATATAAGGGCAGGTAAATGACCCTCCTTGCTCCCAGCATAGTTTAATCGTCCAAGCACAAACACATCACCATTTAGAGAACCGAATATTGAGATAGCGACTGAGACAGGTATTATCCAGGCTACCTCTGGGATAATTCGAACAGCCCANGTAACAGATACAGCAGCTGAAGAAACTATTTCTTTTGGTGTCAGTACTGTGAGGGTATGAGATGTTTACCAGCAAATAAAAGACAATCACTGCAAAACCCGGCTGTTATTTGAACAGAAGCGAAATGTTCCTTTTCCTTGGGGTTTTTTTATGTCCCCTCCACCAAAGGGAAAATTTTAAAC
Full Trace Sequence: ACGTGCATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTGGCTTTTGGGATCTTCAAATATATCTGTGGGAGTCACCTCCAGCAACAGCTGTAAGTAGCAAGTAATGGCATCGAAGTATGGGATACGCAGTTTAAAATAAACAAAAGGGAAATAAATGATCATGCTGCTCAGCATAAACAGTAAGGCATAGAAATATTGCACTTTGGGTGATTGTATTATTGGTGCTAGAACTAAAAATGTGGCGACTAACACAACTCCAAAGGCGATTGGCAGAAAGACCTTATATGGTCTTGGAATGTCTGGTTCTCTGAAGCGTAGAACAATCAGACTTGTAACAGTTAGTCCAATCAAAAGCCAAGAAGAAAAGCCAAAGTAATTAGTTAATGACAGAAGATCTGATGGAATGACGAATACTGATGCAATAATGGTTGAGAGGACTGCAGCCGGAGCCAGAGTCAAGTGATTTACATGAATCATTGATATAAGGGCAGGTAAATGACCCTCCTTGCTCCCAGCATAGTTTAATCGTCCAAGCACAAACACATCACCATTTAGAGAACCGAATATTGAGATAGCGACTGAGACAGGTATTATCCAGGCTACCTCTGGGATAATTCGAACAGCCCANGTAACAGATACAGCAGCTGAAGAAACTATTTCTTTTGGTGTCAGTACTGTGAGGGTATGAGATGTTTACCAGCAAATAAAAGACAATCACTGCAAAACCCGGCTGTTATTTGAACAGAAGCGAAATGTTCCTTTTCCTTGGGGTTTTTTTATGTCCCCTCCACCAAAGGGAAAATTTTAAAC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTGGCTTTTGGGATCTTCAAATAT