ORFeome > slc7a3 ORF1 – XORFeome v1.0

slc7a3 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: slc7a3
Gene ID: 1002488
Gene Page ID: 1002484
ORF Xenbase ID: 17297373

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC042222
Original XGC clone length: 1857

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11014
Well Location: H11

Sequences - 5ʹ (forward) EST

Accession: JZ824254
dbEST ID: 79641956
Trimmed Sequence: ATGAGCAGTAACTGTATAGCAAGCTTTGGAAAGAAGCTTATCCGCAGGAGAGTTATCAGCTTTGACGATAAGGAAACAAGCTTTGCCCGATGCCTGACAACATTGGATCTAACTGCCCTGGGGGTGGGCAGCACTCTTGGAGCTGGGGTATATGTCCTGGCAGGGGAAGTAGCCAAAAAGTCAGCAGGACCTTCCATTGTCCTCTGTTTCCTAGCCGCAGCCCTGTCTTCTGTGTTGGCTGGTCTGTGCTATGCAGAGTTTGGAGCAAGGGTGCCTAAAACTGGATCTGCCTACCTCTACAGCTATGTTACAGTAGGAGAAATATGGGCTTTCACCACTGGATGGAATCTCATCCTCTCTTATGTCTTAGGTACTGCCAGTGTAGCGCGAGCTTGGAGTTCTACGTTTGATGATCTAATTGGAAGCCATATTTCCAACTTCTTCAAGGCAAATGTATCTTTTAAAATTGAGAACGTTCTCGCGGAGTATCCGGATTTCTTTGCTGTGATTCTCATCATTTTGTTAACAGCCCTCCTAGCTATAGGCGTTAGTGAGTCTGCTCTGGTCAATAAGATATTCACTGCAATCAATCTCCTGGTCTTGGCTTTTGTCATTGTATCCGGTTTTGTGAAGGGAGATCTCACCAACTGGAATCTGACTAAAGAACACTATGAAAATTTGACGGCACAATCAACAAATTCAACAGGAATTGGGATCCTTTGGCTCGGGGGGGGGTCACACCCATTGGGTTTTTGGGAGGAGTTGCAACTGGGAGCTGCTGCCCTGTTTCTATTGCATTTGGGTTGGGTTTTTGACTGGCAATTGCCAACC
Full Trace Sequence: GCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGCAGTAACTGTATAGCAAGCTTTGGAAAGAAGCTTATCCGCAGGAGAGTTATCAGCTTTGACGATAAGGAAACAAGCTTTGCCCGATGCCTGACAACATTGGATCTAACTGCCCTGGGGGTGGGCAGCACTCTTGGAGCTGGGGTATATGTCCTGGCAGGGGAAGTAGCCAAAAAGTCAGCAGGACCTTCCATTGTCCTCTGTTTCCTAGCCGCAGCCCTGTCTTCTGTGTTGGCTGGTCTGTGCTATGCAGAGTTTGGAGCAAGGGTGCCTAAAACTGGATCTGCCTACCTCTACAGCTATGTTACAGTAGGAGAAATATGGGCTTTCACCACTGGATGGAATCTCATCCTCTCTTATGTCTTAGGTACTGCCAGTGTAGCGCGAGCTTGGAGTTCTACGTTTGATGATCTAATTGGAAGCCATATTTCCAACTTCTTCAAGGCAAATGTATCTTTTAAAATTGAGAACGTTCTCGCGGAGTATCCGGATTTCTTTGCTGTGATTCTCATCATTTTGTTAACAGCCCTCCTAGCTATAGGCGTTAGTGAGTCTGCTCTGGTCAATAAGATATTCACTGCAATCAATCTCCTGGTCTTGGCTTTTGTCATTGTATCCGGTTTTGTGAAGGGAGATCTCACCAACTGGAATCTGACTAAAGAACACTATGAAAATTTGACGGCACAATCAACAAATTCAACAGGAATTGGGATCCTTTGGCTCGGGGGGGGGTCACACCCATTGGGTTTTTGGGAGGAGTTGCAACTGGGAGCTGCTGCCCTGTTTCTATTGCATTTGGGTTGGGTTTTTGACTGGCAATTGCCAACC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGCAGTAACTGTATAGCAAG

Sequences - 3ʹ (reverse) EST

Accession: JZ829581
dbEST ID: 79647283
Trimmed Sequence: TGCACTGCATGAATGGCCCTTGTATTCTGTGTTGGAAGTCTTTTCTTTGGAATTCTTTTCCTCCACACTGTTCCAAACACCATACACAAAGTAGATTAGAAATCCGATTGCCATCCATATGAGGAATCGTACCCAGGTCCATACATTTAACTGCATCATGAAATACAAATTAATAAATACATTGAAGAGAGGCAGCACTGGGAGGGCAGGTACTTTAAAGTTTAGATGGGTCTTGTTTTCTGGTTGCCTCCAGATAACGATTGTTATTCCAATTGCCATCAGTGCCAGAACTGCACAAAGACTGATCCAAACAGCATTGCCTTCTAAAATGGCATCTATCTTCAGTGCCAGGACTAAGCACAAGAAGATGAAGACAACAGAGATTACAGAAACGCTTCCATAAACAATGCGCCCAGATGTTCTGGTGGGGGAAGCATCACCATCTAGATTTAAAAGGTGTTTCAACTGAAAACTCTTTTCAGGTTCTGAAGTGGCAGCTTCTTTCTCACATTCTTCCCTGTTGAGTCTTTCCATCTCTGTGTCACTGCACGGCTGATCTGGCTGGTACCGAAGAATTGCCACACATGCTGCCACAAGAGAATATGCCAGTAAGGTACCAATTGACATCAGCTCTACTAACACATTCAGCTCAAAAAGGAATGCCATGATAGCTGAGATA
Full Trace Sequence: GCGAGATGCAGGCACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGCACTGCATGAATGGCCCTTGTATTCTGTGTTGGAAGTCTTTTCTTTGGAATTCTTTTCCTCCACACTGTTCCAAACACCATACACAAAGTAGATTAGAAATCCGATTGCCATCCATATGAGGAATCGTACCCAGGTCCATACATTTAACTGCATCATGAAATACAAATTAATAAATACATTGAAGAGAGGCAGCACTGGGAGGGCAGGTACTTTAAAGTTTAGATGGGTCTTGTTTTCTGGTTGCCTCCAGATAACGATTGTTATTCCAATTGCCATCAGTGCCAGAACTGCACAAAGACTGATCCAAACAGCATTGCCTTCTAAAATGGCATCTATCTTCAGTGCCAGGACTAAGCACAAGAAGATGAAGACAACAGAGATTACAGAAACGCTTCCATAAACAATGCGCCCAGATGTTCTGGTGGGGGAAGCATCACCATCTAGATTTAAAAGGTGTTTCAACTGAAAACTCTTTTCAGGTTCTGAAGTGGCAGCTTCTTTCTCACATTCTTCCCTGTTGAGTCTTTCCATCTCTGTGTCACTGCACGGCTGATCTGGCTGGTACCGAAGAATTGCCACACATGCTGCCACAAGAGAATATGCCAGTAAGGTACCAATTGACATCAGCTCTACTAACACATTCAGCTCAAAAAGGAATGCCATGATAGCTGAGATA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGCACTGCATGAATGGCCCT