ORFeome > slc7a6 ORF1 – XORFeome v1.0

slc7a6 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: slc7a6
Gene ID: 963220
Gene Page ID: 963213
ORF Xenbase ID: 17297397

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC130194
Original XGC clone length: 1533

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11085
Well Location: H05

Sequences - 5ʹ (forward) EST

Accession: JZ837778
dbEST ID: 79655480
Trimmed Sequence: ATGAAGGAGACGGAGAACCAGACTGTTCCTCTCAATTCTACAAGCCCTGAAGATACCTCTAATACTTCTAATATGGCTTCTGAAGGCACCCATGAGACCATGCAGCTAAAAAAGGAAATTTCATTGCTTAATGGGGTCAGCCTCATTGTGGGCAACATGATTGGCTCAGGAATCTTTGTGTCACCCAAGGGTGTGCTTATTTACTCTGCCTCCTATGGCCTGTCTCTAATACTTTGGGCATTGGGGGGCATCTTCTCAGTTATTGGGGCCCCTTGCTATGCAGAGCTGGGTACTACTATCAAAAAATCTGGAGCAAGCTATGCTTACATACTTGAAGCCTTCGGTGGCTTTGTTGCCTTTATAAGACTCTGGACCTCTCTACTCATCATTGAACCCACCAGCCAAGCTGTCATTGCTATTACCTTCGCCAATTACCTGGTGCAACCCGTCTTTCCATCTTGTAACCCACCTTATATGGCATCCAGGCTGATTGCTGCTGCTTGCGTGTGTCTCATCACATTTATAAACTGTGCATATGTAAAATGGGGGACACGAGTGCAGGATCTTTTTACCTATGCAAAGGTCATTGCACTAATTGCTATTATCATAACTGGGATTGTCAAACTCTCTCAAGGACAAACAGAGAACTTTGAGGATTCCTTTGCAGGTTCATCATGGGATGCTGGAAACATCTCCTTTAGACTGTACTCTGCACTTTTCT
Full Trace Sequence: TCGCGGGCCATATAATAGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAAGGAGACGGAGAACCAGACTGTTCCTCTCAATTCTACAAGCCCTGAAGATACCTCTAATACTTCTAATATGGCTTCTGAAGGCACCCATGAGACCATGCAGCTAAAAAAGGAAATTTCATTGCTTAATGGGGTCAGCCTCATTGTGGGCAACATGATTGGCTCAGGAATCTTTGTGTCACCCAAGGGTGTGCTTATTTACTCTGCCTCCTATGGCCTGTCTCTAATACTTTGGGCATTGGGGGGCATCTTCTCAGTTATTGGGGCCCCTTGCTATGCAGAGCTGGGTACTACTATCAAAAAATCTGGAGCAAGCTATGCTTACATACTTGAAGCCTTCGGTGGCTTTGTTGCCTTTATAAGACTCTGGACCTCTCTACTCATCATTGAACCCACCAGCCAAGCTGTCATTGCTATTACCTTCGCCAATTACCTGGTGCAACCCGTCTTTCCATCTTGTAACCCACCTTATATGGCATCCAGGCTGATTGCTGCTGCTTGCGTGTGTCTCATCACATTTATAAACTGTGCATATGTAAAATGGGGGACACGAGTGCAGGATCTTTTTACCTATGCAAAGGTCATTGCACTAATTGCTATTATCATAACTGGGATTGTCAAACTCTCTCAAGGACAAACAGAGAACTTTGAGGATTCCTTTGCAGGTTCATCATGGGATGCTGGAAACATCTCCTTTAGACTGTACTCTGCACTTTTCT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAGGAGACGGAGAACCAGA

Sequences - 3ʹ (reverse) EST

Accession: JZ837777
dbEST ID: 79655479
Trimmed Sequence: GTTGGATTTTGCTTCTTCTTTTTTTTCATCGTTAGGATCCATCTCTGTCAAAACACAGCTGAAAATCATCTGAGTCCACCGTGTAAGAAAAGCTAAAATCTTGCTAATGAAAGGAGGCCTTTTGGATTCAGGGAGATAAATTCCCATGAAGTAGACAGGAATCCCAGACAAGGCTATGCCAATCCCAATAAGAGAATTCACAGTATCACTGTACAGTGGAACAATCACCAGAAAGACTGTACACAGGCAAAATACGATGGGGTAAAACAAGCTGAGCTTGACTGGTCGTGGTAGTTCAGGCCTTTTATAGCGCAGATAAATCTGACCAGCTATAGACAGGCCAACAAAGAACCAGTAACTGAAACTGTAATAGTTGATAAGCTGGAAGACATCTTTCACAGCCAAATAGACGAGGGTAGCAGCACAATTAAACAGCAGTGCAGGCACAGGAGTAAACCTCTCTCGATGGATTAAGCACAGCATGTCAGGTAGATGTCCCTCCCTTGCTCCAACAAAGAACAGCCTGGAGGCAGCAAGAATGGAAGAGTTAAGTCCACCGAAACAGGAAAGTGCCACAGCCACAGGGTATTGTCCAACTGAAAACGCCATATACCAGGTCAGCGAACGTCACTGCAACTGCTTCACTGGCAACAACAGCGTTGAAATCTAAACAGTATAATAAGCTACATTGGTCAAAATATATATAATAGTGACAAGTGGGATGGGAAATCCCAATGGATAAAGGGAGGTTTCCTTTCTTGGTTTCTTAATTTCTTCAGTTACCAAATTCAATTGTGTCCCAGCCCCAAAAAAAAAAAAAAAGTGCAGAGTACGAGTCCTAAAAAAGATATCTTCCGCCATCCCCACGAAGAACCTGGAAAAGGAATTCTACAAAGTTTCTCTTTTTGGCCTTTTGAAAGAATTAAACAAGCCCAGGTTAAGAAAAATAGAAAATTAAATGGGAATGAGGGCTTTTGCAAAGTTAAAAGAAAATCGCGGCAGCTCGCGTTCCCCCGCGTGTTGTGGATATGCGCAAGGTATTAAAAAAGTGTGAAAAAAAAAAACCCCGGCAAGCCAGCCCACCCAAGACACCCCCCGGCCATACCCCCTAAAACAAGGGGGTGGGGTTTAACAAAAGAAAGGAAAAGGAGAAAAGAGAATTTTGTC
Full Trace Sequence: GGGGCGGGTAACAGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTTGGATTTTGCTTCTTCTTTTTTTTCATCGTTAGGATCCATCTCTGTCAAAACACAGCTGAAAATCATCTGAGTCCACCGTGTAAGAAAAGCTAAAATCTTGCTAATGAAAGGAGGCCTTTTGGATTCAGGGAGATAAATTCCCATGAAGTAGACAGGAATCCCAGACAAGGCTATGCCAATCCCAATAAGAGAATTCACAGTATCACTGTACAGTGGAACAATCACCAGAAAGACTGTACACAGGCAAAATACGATGGGGTAAAACAAGCTGAGCTTGACTGGTCGTGGTAGTTCAGGCCTTTTATAGCGCAGATAAATCTGACCAGCTATAGACAGGCCAACAAAGAACCAGTAACTGAAACTGTAATAGTTGATAAGCTGGAAGACATCTTTCACAGCCAAATAGACGAGGGTAGCAGCACAATTAAACAGCAGTGCAGGCACAGGAGTAAACCTCTCTCGATGGATTAAGCACAGCATGTCAGGTAGATGTCCCTCCCTTGCTCCAACAAAGAACAGCCTGGAGGCAGCAAGAATGGAAGAGTTAAGTCCACCGAAACAGGAAAGTGCCACAGCCACAGGGTATTGTCCAACTGAAAACGCCATATACCAGGTCAGCGAACGTCACTGCAACTGCTTCACTGGCAACAACAGCGTTGAAATCTAAACAGTATAATAAGCTACATTGGTCAAAATATATATAATAGTGACAAGTGGGATGGGAAATCCCAATGGATAAAGGGAGGTTTCCTTTCTTGGTTTCTTAATTTCTTCAGTTACCAAATTCAATTGTGTCCCAGCCCCAAAAAAAAAAAAAAAGTGCAGAGTACGAGTCCTAAAAAAGATATCTTCCGCCATCCCCACGAAGAACCTGGAAAAGGAATTCTACAAAGTTTCTCTTTTTGGCCTTTTGAAAGAATTAAACAAGCCCAGGTTAAGAAAAATAGAAAATTAAATGGGAATGAGGGCTTTTGCAAAGTTAAAAGAAAATCGCGGCAGCTCGCGTTCCCCCGCGTGTTGTGGATATGCGCAAGGTATTAAAAAAGTGTGAAAAAAAAAAACCCCGGCAAGCCAGCCCACCCAAGACACCCCCCGGCCATACCCCCTAAAACAAGGGGGTGGGGTTTAACAAAAGAAAGGAAAAGGAGAAAAGAGAATTTTGTC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTTGGATTTTGCTTCTTCT