ORFeome > slco1a2 ORF1 – XORFeome v1.0

slco1a2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: slco1a2
Gene ID: 6255431
Gene Page ID: 6456767
ORF Xenbase ID: 17297433

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC060021
Original XGC clone length: 1950

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11017
Well Location: D10

Sequences - 5ʹ (forward) EST

Accession: JZ824436
dbEST ID: 79642138
Trimmed Sequence: ATGGGCCAAGTGGCTCGGAATGGGTCAGCCAAGAAGCCACGTGGCATCTCCAAACTGAAGATATTTATCTTCGCTCTATCGTACGCCTACGTTGCCAAGACCCTGGCCTATGCCTACTCGGAAAGCATCATCACCCAGATAGAGAGAAGGTTCAACATCCCGTCCTCCACCATCGGCATCATCAATGGCAGCTTCACCATCGGGAACGTGCTGGTAATTGCCTTTGTGAGCTACTTCGGTGCCAAACTACATCGACCCAAAGTAATTGGGCTGGGGTGCTTGATCATGTCCCTTGGGAGTGGTCTGGCGGCGTTACCCCACTTGCTGATGCCGAGATATGAATATGAGAGCACAGTCTCGACAACAAGCAACTCCACAAGTCGGGTCCCTCTCTGTCTGGCCAACCAGAGTCTCTCACACAACGTGGAGCTCCCAGGAGAGTGTCTGGGCGGCTCCATGTCCCTGATGTGGATCTTTGTGCTGGTGGGAAATCTCCTGAAGGGAATCGGGGAGACCCCAGTAGAACCATTGGGCCTCTCATATGTGGACGAGTTCTCAAAAAAAGAAAATTCTCCCTTCTATATTGGGATAATACAGACCATATCGATTGTGGGGCCACTCCTGGGGTACCTACTGGCGGCTCTCTGTGCCCAGCTCTATGTGGATATTGGATCAATAAACTTGGATGACGTCACAATCGCACAAACAGATATCCGGTGGGTTGGCGCATGGTGGGATTGGGGTTTTTTTGCAGCTCAGGGGGCATGTTTTCTTGGCCACTCCTACTC
Full Trace Sequence: CCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGCCAAGTGGCTCGGAATGGGTCAGCCAAGAAGCCACGTGGCATCTCCAAACTGAAGATATTTATCTTCGCTCTATCGTACGCCTACGTTGCCAAGACCCTGGCCTATGCCTACTCGGAAAGCATCATCACCCAGATAGAGAGAAGGTTCAACATCCCGTCCTCCACCATCGGCATCATCAATGGCAGCTTCACCATCGGGAACGTGCTGGTAATTGCCTTTGTGAGCTACTTCGGTGCCAAACTACATCGACCCAAAGTAATTGGGCTGGGGTGCTTGATCATGTCCCTTGGGAGTGGTCTGGCGGCGTTACCCCACTTGCTGATGCCGAGATATGAATATGAGAGCACAGTCTCGACAACAAGCAACTCCACAAGTCGGGTCCCTCTCTGTCTGGCCAACCAGAGTCTCTCACACAACGTGGAGCTCCCAGGAGAGTGTCTGGGCGGCTCCATGTCCCTGATGTGGATCTTTGTGCTGGTGGGAAATCTCCTGAAGGGAATCGGGGAGACCCCAGTAGAACCATTGGGCCTCTCATATGTGGACGAGTTCTCAAAAAAAGAAAATTCTCCCTTCTATATTGGGATAATACAGACCATATCGATTGTGGGGCCACTCCTGGGGTACCTACTGGCGGCTCTCTGTGCCCAGCTCTATGTGGATATTGGATCAATAAACTTGGATGACGTCACAATCGCACAAACAGATATCCGGTGGGTTGGCGCATGGTGGGATTGGGGTTTTTTTGCAGCTCAGGGGGCATGTTTTCTTGGCCACTCCTACTC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGCCAAGTGGCTCGGAA

Sequences - 3ʹ (reverse) EST

Accession: JZ829792
dbEST ID: 79647494
Trimmed Sequence: CTTCTCTTGTGTTTCTGCCCTTCCAGCGGGGGGAGGGGCGCTGTCCCGCTGAGCTTGCTCTCGTTTCAGGCTGAGGAGGATGAAAATGCAGGGGACGTAGGAAGACATCCGTATGACGCACTGGATCCCGTTGAACAGGTACCTGAATAGATCAGTGTCGTAAATACGGCAAGCCCCGGGCTCCCCGCATTCCAGAACCCCCCATTTCAGACACGTGGAATCCACTAATACTCCAAAGGAAACTAAGGAAGGGATCCCACCAACAGTCCGTGCTGCCAGTAGATGGAGGCCGAGTCCCAATGACTTTTCTTCAGGTTTCAGGCTCCGGATCAGCACCATATACGCCGGCATGGCTCCGAAGGAGAAGATCAGACAGCAGATGAAAGACATGACCATGAAGTATATGAGCATGGAGTCACATGTCTCCTCCCGGGGGCACTGGCCCAGCGTGGCGCTGCCATTGGATGGGAAGGGTGAGGCCAACACACAGCTGCAGTTCTGGAAGATTGTGTTTTGCCCCTCCCCTACAGATGCCGTACAGCCGGCGTGACAAGCCGAAATATAGACCAGGCCGTTATCCCCGCACACCGGGTCCCACACGTCCCACGGGCAGTCGCAGGGGCTGTTGCAGCTGGGACGTAAAGTTGTTCAGGTAGGAAATGTGATCAGTGCCATCATACAACACGGTGAGATCCCATCACTGGGTGAATTCTTGCCAGCCCATTTACAACCACCCAGGAAAATTAAAGGGGAAAAACGGCTAGTGAAT
Full Trace Sequence: ACGTGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTTCTCTTGTGTTTCTGCCCTTCCAGCGGGGGGAGGGGCGCTGTCCCGCTGAGCTTGCTCTCGTTTCAGGCTGAGGAGGATGAAAATGCAGGGGACGTAGGAAGACATCCGTATGACGCACTGGATCCCGTTGAACAGGTACCTGAATAGATCAGTGTCGTAAATACGGCAAGCCCCGGGCTCCCCGCATTCCAGAACCCCCCATTTCAGACACGTGGAATCCACTAATACTCCAAAGGAAACTAAGGAAGGGATCCCACCAACAGTCCGTGCTGCCAGTAGATGGAGGCCGAGTCCCAATGACTTTTCTTCAGGTTTCAGGCTCCGGATCAGCACCATATACGCCGGCATGGCTCCGAAGGAGAAGATCAGACAGCAGATGAAAGACATGACCATGAAGTATATGAGCATGGAGTCACATGTCTCCTCCCGGGGGCACTGGCCCAGCGTGGCGCTGCCATTGGATGGGAAGGGTGAGGCCAACACACAGCTGCAGTTCTGGAAGATTGTGTTTTGCCCCTCCCCTACAGATGCCGTACAGCCGGCGTGACAAGCCGAAATATAGACCAGGCCGTTATCCCCGCACACCGGGTCCCACACGTCCCACGGGCAGTCGCAGGGGCTGTTGCAGCTGGGACGTAAAGTTGTTCAGGTAGGAAATGTGATCAGTGCCATCATACAACACGGTGAGATCCCATCACTGGGTGAATTCTTGCCAGCCCATTTACAACCACCCAGGAAAATTAAAGGGGAAAAACGGCTAGTGAAT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTCTCTTGTGTTTCTGCCCT