ORFeome > slx1a ORF1 – XORFeome v1.0

slx1a ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: slx1a
Gene ID: 6252778
Gene Page ID: 959774
ORF Xenbase ID: 17297457

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123264
Original XGC clone length: 849

Human orthology & disease relationships

NCBI Entrez ID: 548593
Ensembl gene IDs: ENSG00000132207,ENSG00000181625
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11092
Well Location: C02

Sequences - 5ʹ (forward) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: TCGAGGCCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGTGGTGGAAGTGGAGGGTTTCTATGGTGTTTACCTCCTGTTCTGCACCAACCCCAAGTACAAAGGTCGCATCTACCTTGGCTTCACAGTGAACCCCGAAAGGCGCATCCCGCAGCACAATGGCCGCAAACACAAAGAAGGTGCCTGAAATACGAGTGGCATAGGCCCCTGGGACATGGTTCTGATAGTCCATGGATTTCCCAATGACATTGCAACATTGCGGTTTGAGTAGAGAATGGCACCACCCCCACTTATCTCGTCGCCTCACCCGCGTCCCCCGCCATACCAACAAACAAATCCANTTTTTACTACCACCTCCTTGTCCTTTGCTCACATGCTGCATGTAGGGCCCAGGAATCGAGCTGCTTTACACCTACATTTCTCATCCTCCCTATAAATCACATGAAAGTAACACCTCCTCCACCATCTACCCCTTCAAATACCATTAACATTATGACAACAACAAACAGAACCCGCACCCTAATATAAATAACAATAACATCAGATAATGTCTGGGAAAAAAGTCAAATGCAAAATGAATAACGAATTAATCATAGGCGATGGGCCGAAATTGGTATTTCGCAGAAATCACTAAATAAAAAAAAAAGTAAGGAGAAAAGGAAATAAGTATCCTTACGTGGGCCCGAAACTCCCTGTCATAGACGCCCAGCCACGACTAGGTATGGGTAAACTACAAACACACAACCATATGTTAAACGACCAATATAGTGAACCATTATAACGATACAGATACATGCAATGTTTCCATCTCCTCGTTTTCCCCCACCACCTCCCACCAACGAAATGCATACGACG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTGGTGGAAGTGGAG

Sequences - 3ʹ (reverse) EST

Accession: JZ838753
dbEST ID: 79656455
Trimmed Sequence: GTCAGAGCATCTGTGCAGCTCGTCCCCCCAGTGTGCCTGTGAGCTTGAGATTTCCTCTAGGTCTCCATAGCAACCATTCCTGTGTCGGATCAGGTCCCCCCACAGTAGCGAGTGGCCGCAGCTGGGGCACAGGCCCTCTACAGGAATGAGATTTTGGGGTTCGTTTAGCAGGAAGAGCTTGGCCAGACACATGATGTGAGCAGTGAGGGTGCAGCCAGGGTGGAAGCAGTGCAGAGAGTCGTCCTTATCCTGTACCCTCTCATAACAGACTCTGCAGCGCTGCACAACTGCGTCTCCCAGCAGGATCACCTCCTGTTCTGTCTCTTCTGCCCTGTTCTCCCCCAATCTGCCCTTCTCCTTCTCTCCTTTAGGGATGGGCCGTGCCCGTACTTGCCCAAAAGCCAGAGGCATGTGCAGCGGGGGCTGGAGGAGGAGGGGCAATTCCCTGCGATACTCCTGGCGCAGCCAACGTAGGGTTAAGGGCAGCCGATTCCACGGGGCCACTCGCAGCATGTGGCAAAGCACCAGCAGGTGGAAGTCAAAACTGGACTGTTTCTTGGTCTTGCGGGGGACGTGGGTGAGGCGACGGGACCACTGGGGGGTGCTGCCCCCCCCACTCCAACCGCAATGGCGCAAAGTCCTTTGGAAAATCCATGAAACTATCGAAACCATGGCTCCCAGGGGCCCCCTGGCCCTTCGTCCTTCCGGGGCCCCTTCCCCTTGGTGTTTGGCGGCCCTTTTTGGCTTGCGTGGGGATGCG
Full Trace Sequence: AAACAGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTCAGAGCATCTGTGCAGCTCGTCCCCCCAGTGTGCCTGTGAGCTTGAGATTTCCTCTAGGTCTCCATAGCAACCATTCCTGTGTCGGATCAGGTCCCCCCACAGTAGCGAGTGGCCGCAGCTGGGGCACAGGCCCTCTACAGGAATGAGATTTTGGGGTTCGTTTAGCAGGAAGAGCTTGGCCAGACACATGATGTGAGCAGTGAGGGTGCAGCCAGGGTGGAAGCAGTGCAGAGAGTCGTCCTTATCCTGTACCCTCTCATAACAGACTCTGCAGCGCTGCACAACTGCGTCTCCCAGCAGGATCACCTCCTGTTCTGTCTCTTCTGCCCTGTTCTCCCCCAATCTGCCCTTCTCCTTCTCTCCTTTAGGGATGGGCCGTGCCCGTACTTGCCCAAAAGCCAGAGGCATGTGCAGCGGGGGCTGGAGGAGGAGGGGCAATTCCCTGCGATACTCCTGGCGCAGCCAACGTAGGGTTAAGGGCAGCCGATTCCACGGGGCCACTCGCAGCATGTGGCAAAGCACCAGCAGGTGGAAGTCAAAACTGGACTGTTTCTTGGTCTTGCGGGGGACGTGGGTGAGGCGACGGGACCACTGGGGGGTGCTGCCCCCCCCACTCCAACCGCAATGGCGCAAAGTCCTTTGGAAAATCCATGAAACTATCGAAACCATGGCTCCCAGGGGCCCCCTGGCCCTTCGTCCTTCCGGGGCCCCTTCCCCTTGGTGTTTGGCGGCCCTTTTTGGCTTGCGTGGGGATGCG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTCAGAGCATCTGTGCAGCTCGT