ORFeome > smad1 ORF1 – XORFeome v1.0

smad1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: smad1
Gene ID: 1018199
Gene Page ID: 1018192
ORF Xenbase ID: 17297469

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC057746
Original XGC clone length: 1395

Human orthology & disease relationships

NCBI Entrez ID: 4086
Ensembl gene IDs: ENSG00000170365
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 112600,158350,174900,202370,214100,235730,261550,266510,609192,609441,610069

Library Location

Plate ID: GDExl11021
Well Location: E05

Sequences - 5ʹ (forward) EST

Accession: JZ824731
dbEST ID: 79642433
Trimmed Sequence: ATGAATGTGACAAGCCTTTTCTCCTTCACAAGCCCAGCTGTGAAGAGGCTGCTTGGTTGGAAACAGGGAGACGAAGAAGAGAAATGGGCAGAGAAAGCGGTGGATGCCTTGGTGAAAAAGCTGAAGAAGAAAAAAGGAGCCATGGAAGAACTTGAAAAGGCCCTGAGTTGTCCTGGACAGCCCAGTAACTGTGTCACCATTCCTCGTTCCTTGGATGGCCGACTGCAAGTGTCTCACCGTAAGGGCCTACCGCATGTCATTTATTGCAGAGTGTGGCGTTGGCCTGATCTACAGAGTCACCATGAACTGAAACCCTTGGAGTGTTGCGAGTATCCCTTTGGTTCCAAACAGAAGGAGGTCTGCATCAACCCATATCATTATAAACGAGTGGAGAGTCCTGTCTTGCCGCCTGTCCTTGTTCCACGGCACAGTGAGTACAACCCTCAACACAGTCTCCTTGCGCAATTCCGAAACTTGGAGCCAAGTGAGCCACACATGCCTCACAACGCAACTTTTCCCGACTCTTTCCAGCAGCCAAACAGCCATCCGTTCCCTCACTCGCCCAACAGCAGCTACCCAAACTCTCCGGGGAGCAGCAGTACTTACCCTCACTCACCGGCGAGCTCTGATCCTGGAAGCCCTTTTCAAATACCAGCTGACACCCCTCCTCCAGCTTATATGCCCTCCTGAGGATCAGATGACGCAGGACCACTCTCACCCGATGGGAACAAATTATAATGGGGGCCAACATCCCCTCAGAATATCATTAAAACAAAAAGTACAAGCCGGTTTCCCTA
Full Trace Sequence: AAATGGATTTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAATGTGACAAGCCTTTTCTCCTTCACAAGCCCAGCTGTGAAGAGGCTGCTTGGTTGGAAACAGGGAGACGAAGAAGAGAAATGGGCAGAGAAAGCGGTGGATGCCTTGGTGAAAAAGCTGAAGAAGAAAAAAGGAGCCATGGAAGAACTTGAAAAGGCCCTGAGTTGTCCTGGACAGCCCAGTAACTGTGTCACCATTCCTCGTTCCTTGGATGGCCGACTGCAAGTGTCTCACCGTAAGGGCCTACCGCATGTCATTTATTGCAGAGTGTGGCGTTGGCCTGATCTACAGAGTCACCATGAACTGAAACCCTTGGAGTGTTGCGAGTATCCCTTTGGTTCCAAACAGAAGGAGGTCTGCATCAACCCATATCATTATAAACGAGTGGAGAGTCCTGTCTTGCCGCCTGTCCTTGTTCCACGGCACAGTGAGTACAACCCTCAACACAGTCTCCTTGCGCAATTCCGAAACTTGGAGCCAAGTGAGCCACACATGCCTCACAACGCAACTTTTCCCGACTCTTTCCAGCAGCCAAACAGCCATCCGTTCCCTCACTCGCCCAACAGCAGCTACCCAAACTCTCCGGGGAGCAGCAGTACTTACCCTCACTCACCGGCGAGCTCTGATCCTGGAAGCCCTTTTCAAATACCAGCTGACACCCCTCCTCCAGCTTATATGCCCTCCTGAGGATCAGATGACGCAGGACCACTCTCACCCGATGGGAACAAATTATAATGGGGGCCAACATCCCCTCAGAATATCATTAAAACAAAAAGTACAAGCCGGTTTCCCTA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAATGTGACAAGCCTTTTCTCC

Sequences - 3ʹ (reverse) EST

Accession: JZ830083
dbEST ID: 79647785
Trimmed Sequence: AGAGACAGAGGAGATGGGATTATGGGGTGAGCCCATCTGAGTAAGTACTTTATCCAGCCATTGAAGTGGCCCATGAAGGTGAATCTCAATCCAGCAGGGGGTGCTTGTCACATCCTGCCGATGATATTCCGCACCCCAGCCCTTGACAAAACTCATTCGAATAGTGCACATCTTTGTCAGTTCATAGACCGTTTCAAAGCCATGGTTTACAGACTGGGCCAAAAGCTGAGCAAATTCCTGGTTGTTAAAGATCTTCAGACTGCACCCGCTGGGGATTTTACACACAGTTGTAGGATGAAAACCATGGTGGAAGTTACAATTCCGACTCTGAACAAAAATGCTGCTGTCGCTTAAGCATTCAGCATAGACCTCACCCCCGACGTAGTATAAATGCACACCTTTCCCAATATGCCGCCTGGTGTTCTCAATGGTCGAGTTCCGGTTGACATTGGACAGAAGCCCAAGGCAAAATCTGTTCCTGTTGTTTGAAGGATCAGTGAAGCCGTCCACCAATACACTTGTGGAGGAGGCATGGAAAGCTTCTCCTACACGGTTGTTCAGCTCATAATAGACAATGGAGCACCAGTGTTTTGGCTCTTCATAGGCAACAGCTTGTACATCTGCTCTATTGATATNCTTGAGAGATGTTAGGCACCATCATATTTGTGTCCCATCGGCTGAGAGTTTGGTCTTGGCGTCATCTGGATCTTCAGGAAGCATATAAAACCCTTGGAAGAAGGGGGTGGTTCAACCGGGG
Full Trace Sequence: GGTCCGGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGAGACAGAGGAGATGGGATTATGGGGTGAGCCCATCTGAGTAAGTACTTTATCCAGCCATTGAAGTGGCCCATGAAGGTGAATCTCAATCCAGCAGGGGGTGCTTGTCACATCCTGCCGATGATATTCCGCACCCCAGCCCTTGACAAAACTCATTCGAATAGTGCACATCTTTGTCAGTTCATAGACCGTTTCAAAGCCATGGTTTACAGACTGGGCCAAAAGCTGAGCAAATTCCTGGTTGTTAAAGATCTTCAGACTGCACCCGCTGGGGATTTTACACACAGTTGTAGGATGAAAACCATGGTGGAAGTTACAATTCCGACTCTGAACAAAAATGCTGCTGTCGCTTAAGCATTCAGCATAGACCTCACCCCCGACGTAGTATAAATGCACACCTTTCCCAATATGCCGCCTGGTGTTCTCAATGGTCGAGTTCCGGTTGACATTGGACAGAAGCCCAAGGCAAAATCTGTTCCTGTTGTTTGAAGGATCAGTGAAGCCGTCCACCAATACACTTGTGGAGGAGGCATGGAAAGCTTCTCCTACACGGTTGTTCAGCTCATAATAGACAATGGAGCACCAGTGTTTTGGCTCTTCATAGGCAACAGCTTGTACATCTGCTCTATTGATATNCTTGAGAGATGTTAGGCACCATCATATTTGTGTCCCATCGGCTGAGAGTTTGGTCTTGGCGTCATCTGGATCTTCAGGAAGCATATAAAACCCTTGGAAGAAGGGGGTGGTTCAACCGGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGAGACAGAGGAGATGGGA