ORFeome > smad9 ORF1 – XORFeome v1.0

smad9 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: smad9
Gene ID: 865114
Gene Page ID: 484685
ORF Xenbase ID: 17297505

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC057741
Original XGC clone length: 1398

Human orthology & disease relationships

NCBI Entrez ID: 4093
Ensembl gene IDs: ENSG00000120693
Directly associated (OMIM) disease MIM numbers: 615342
Indirectly associated (Lage, et al.) disease MIM numbers: 112600,158350,174900,261550,609441,610069

Library Location

Plate ID: GDExl11020
Well Location: G05

Sequences - 5ʹ (forward) EST

Accession: JZ824632
dbEST ID: 79642334
Trimmed Sequence: ATGCACGCCAGCACTCCCATCAGCTCGTTGTTCTCCTTCACTAGCCCTGCTGTCAAACGGCTGCTTGGCTGGAAGCAAGGAGACGAAGAAGAAAAATGGGCAGAGAAAGCGGTGGATTCGCTTGTGAAGAAACTGAAGAAGAAGAAAGGAGCAATGGAAGAACTAGAAAGGGCTTTAAGTTGTCCGGGGCAGCCTAGTAAATGTGTCACTATCCCACGGTCACTGGATGGGAGGTTACAGGTGTCACATCGCAAAGGCCTCCCTCATGTCATCTATTGCCGGGTTTGGAGGTGGCCTGATCTGCAGTCCCATCATGAGTTAAAACCAATGGAATGCTGTGAGTTCCCTTTTGTGTCCAAGCAGAAGGACGTGTGCATTAACCCCTACCACTACCGTAGGGTGGAAACACCAGTGTTGCCCCCGGTGCTTGTTCCAAGACACAGCGAGTTCAACCCACAGCTGAGCCTTCTAGCAAAGTTCCGAAACACCTCACTGAATAATGAACCACTAATGCCGCACAATGCAACTTTCCCAGAGTCTTTCCAGCAGCCGCCATGCACTCCATTCTCTTCCTCACCAAGTAACATGTTCCCTCAGTCCCCAAACACAGTGAGCTATCCAGATTCTCCCTAGGAGTTCCACGGACCCAGGAAGCCCATACCAGATCACAGAAGACGCCCCCTCCACCATATAAGTGCTCCCAACCTTCAAGGGGATCAAAACCGACCAACTACCAAAACCACCGAAATGCCCACTAGTGTTTTGTCCACCCCT
Full Trace Sequence: TAATGATTTTTAATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCACGCCAGCACTCCCATCAGCTCGTTGTTCTCCTTCACTAGCCCTGCTGTCAAACGGCTGCTTGGCTGGAAGCAAGGAGACGAAGAAGAAAAATGGGCAGAGAAAGCGGTGGATTCGCTTGTGAAGAAACTGAAGAAGAAGAAAGGAGCAATGGAAGAACTAGAAAGGGCTTTAAGTTGTCCGGGGCAGCCTAGTAAATGTGTCACTATCCCACGGTCACTGGATGGGAGGTTACAGGTGTCACATCGCAAAGGCCTCCCTCATGTCATCTATTGCCGGGTTTGGAGGTGGCCTGATCTGCAGTCCCATCATGAGTTAAAACCAATGGAATGCTGTGAGTTCCCTTTTGTGTCCAAGCAGAAGGACGTGTGCATTAACCCCTACCACTACCGTAGGGTGGAAACACCAGTGTTGCCCCCGGTGCTTGTTCCAAGACACAGCGAGTTCAACCCACAGCTGAGCCTTCTAGCAAAGTTCCGAAACACCTCACTGAATAATGAACCACTAATGCCGCACAATGCAACTTTCCCAGAGTCTTTCCAGCAGCCGCCATGCACTCCATTCTCTTCCTCACCAAGTAACATGTTCCCTCAGTCCCCAAACACAGTGAGCTATCCAGATTCTCCCTAGGAGTTCCACGGACCCAGGAAGCCCATACCAGATCACAGAAGACGCCCCCTCCACCATATAAGTGCTCCCAACCTTCAAGGGGATCAAAACCGACCAACTACCAAAACCACCGAAATGCCCACTAGTGTTTTGTCCACCCCT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCACGCCAGCACTCC

Sequences - 3ʹ (reverse) EST

Accession: JZ829982
dbEST ID: 79647684
Trimmed Sequence: CGATACAGAAGAGATTGGATTATGCGGTGAGCCCATCTGCGTCAGAACCTTGTCCAGCCACTGGAGAGGCCCATGTAAATGGATTTCAATCCAGCAGGGGGTGCTAGTTACATCCTGTCGGTGGTATTCTGCTCCCCATCCTTTAACAAAGCTCATTCGAATGGTGCACATTTTCGTCAGTTCATAAACCACCTCGAAGCCTTGGTTAACGGACTGGGAAAGAAGCTGGGCAAATAGTTGGTTATTAAATATCTTGAGGCTGCAGCCGCTGGGGATCTTGCAGACAGTGGAAGGATGGAAGCCATGCTGGTAATTGCAGTTGCGACTCTGTACGAAAATGCTGCTGTCGCTCACACATTCTGCGTACACCTCTCCACCCACGTAGTAAAGATGGACCCCTTTTCCGATATGCCTGCGGGTGTTTTCAATAGTGGAGTTGCGGTTGACGTTTGAGAGAAGCCCTAAGCAGAATCTGTTCTTGTTATTGGAGGGGTCTGTGAATCCGTCAATGAGGACGCTGCGTGAGGAGGCTTGGAACGTCTCCCCTACTCGGTTATTCAGTTCATAATAAGCAACAGAACACCAGTGCAAAGGCTCTTCATAGCAAACAGGGCGAAAGTCTCTGTTCAGAGCTGACAAAACATACTGGCATTCAGCTGGGTTCTGGTAGTTGGTCTGGTTTTGATCCCCTTGAAGGTCTGGGAACATTTATATGGGTTGGAAGGGGGGCCGTCTCCTGGTGAATCCTGGGTATGGGGGCCTTC
Full Trace Sequence: GGCCGGGTAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACGATACAGAAGAGATTGGATTATGCGGTGAGCCCATCTGCGTCAGAACCTTGTCCAGCCACTGGAGAGGCCCATGTAAATGGATTTCAATCCAGCAGGGGGTGCTAGTTACATCCTGTCGGTGGTATTCTGCTCCCCATCCTTTAACAAAGCTCATTCGAATGGTGCACATTTTCGTCAGTTCATAAACCACCTCGAAGCCTTGGTTAACGGACTGGGAAAGAAGCTGGGCAAATAGTTGGTTATTAAATATCTTGAGGCTGCAGCCGCTGGGGATCTTGCAGACAGTGGAAGGATGGAAGCCATGCTGGTAATTGCAGTTGCGACTCTGTACGAAAATGCTGCTGTCGCTCACACATTCTGCGTACACCTCTCCACCCACGTAGTAAAGATGGACCCCTTTTCCGATATGCCTGCGGGTGTTTTCAATAGTGGAGTTGCGGTTGACGTTTGAGAGAAGCCCTAAGCAGAATCTGTTCTTGTTATTGGAGGGGTCTGTGAATCCGTCAATGAGGACGCTGCGTGAGGAGGCTTGGAACGTCTCCCCTACTCGGTTATTCAGTTCATAATAAGCAACAGAACACCAGTGCAAAGGCTCTTCATAGCAAACAGGGCGAAAGTCTCTGTTCAGAGCTGACAAAACATACTGGCATTCAGCTGGGTTCTGGTAGTTGGTCTGGTTTTGATCCCCTTGAAGGTCTGGGAACATTTATATGGGTTGGAAGGGGGGCCGTCTCCTGGTGAATCCTGGGTATGGGGGCCTTC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACGATACAGAAGAGATTGGATTATG