ORFeome > smarcc1 ORF1 – XORFeome v1.0

smarcc1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: smarcc1
Gene ID: 5906854
Gene Page ID: 5906749
ORF Xenbase ID: 17297547

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC044014
Original XGC clone length: 3681

Human orthology & disease relationships

NCBI Entrez ID: 6599
Ensembl gene IDs: ENSG00000173473
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 124900,125800,161800,301000,313900,600652,603278,603622,605249,608751,609322

Library Location

Plate ID: GDExl11015
Well Location: E05

Sequences - 5ʹ (forward) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: AATAGATTTTTATTTTTTACTGTATATTGACATGTCTCTCTTGCCCAAATTGTTGAGCAAGGCTTTTTTTTATATGCCGCCTTTGTCAAAAAATTTGGCACCATGTCGGAGATGACATGCGCACCTGACCTGATAGGGGCGGCTGCACCTTTAGCAGCAACGGCAACTCCATGGACTTCACATGATCAACCAGTGGCTCATGGATTAACATCTGGAGATACACTGGCAGTCAGGAGATACCGCGCCGATGCGCGCACTATAGGTTGGTTTCTTCCTCGCTCCCCCATCACACACTTCCCAATTGCTGCTTCTGAACCCAGATCGCGGTTTCACCGGCCTGCCTGACTCTGTAAGTCATAGCACATCACCATGGGATCTCCTGGACCTCGAACAATAATAGTATCAGCAAGTCGTCCAGGATAAGCTACAAATACTCTCATTCACGCTCAAGAAGGTACACTTTATTCCCACAACATATTTACAGCGTACTATACTCTGCGGGCCGTATGTTTACAGGGTAGCTTTCTGTACTGCTCATCGAGTGAGCGAATCGTGCGTGTGCTGACGTACTAGTACGCGTAAAAGCGCTGCTCCACACTATACTTCTATACACTTGCTTACAGGATCTCGATCATCAATACTTGGCTGTACACACTCTAGTCGTACGACTTGACCCTCCGAAAACCTTCAGACTTCCACATAAATACCTTCTCAACTCTCTGCCTATCCGTCTCTACTCTCCTCAGCCATGCCAATAGAGACGAGGCCCATGAGATCTCAAAGGAGCGCCTCTTATGAGGAAGCCCGAATTGAACGCCTCCACCTACCTTCCAATCCCCAAAAACCATAATAAAGGAACCCTGCCGAAACCACGCCATTTAAAGCCATGGAGGGTCCTTTTTACCCTTTTAAAAAACTGTTTCCCCTTTTCCCCGCAAAAACGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAACAAAGGCAGGTGG

Sequences - 3ʹ (reverse) EST

Accession: JZ829536
dbEST ID: 79647238
Trimmed Sequence: CTCAAATACAAAAACAGAGTCAGTCGGGGTCGATCTCCTTTGCGGGGTTAAAAGTACTCGGCTGAGTGGTTTATCTATGGTGCGGCCGAGGCCGGAGTTGCCGTGGGAGGAGGAGTCTGTCCGTCCGTAGGGGGAGGCGGCTGCTGCGGTGGTTGTGGGGGGGCCGGGATACATGCCGTTAGGTGCCATGGGTGGGCGTGATCCCATCATAGTGCCAGGCATATTGGGCATACCAGAAGGAGGTGGATGAATATTGGGCATCATGCGGCCTGGCATGGGAGGTCCAGTCATCATGGAACTTGGCCCTGGCATCTGACCTGGCTGTGAGGGGTGAGGAGGAGGCATCTGCTGGTGAACCCCATAAGGGGGAGGCTGCTGCTGTGCTTGGTGCCCCATCATTCCAGGAAGATTAGGGGCTCCTATATGCCCCATATTGGACCCTGCAGGCCCCCCTTGGAGTTGAGTGTTCTGGCTGTGTTGTTGTTGTTGCTGCTGCTGCTGCTGCTGTTCCAGTTGCTGTCTGGCTCTCATCTCAGCATATTTCAGCTGTTCCATGTGAAAGTTCTGGCGCTCATTAAGAAGCTGTTGCCTCTGTTGTTCCAGTGCTTCCTTTTCTCTGGTCATGATGGTCTCAAGTTCTTCAAAATGCCTCAGCTTGATCTCTAGCTTCTTCATCTGATTTTCTAACCACAAAAGCCACCAGAAGACTTGATCTTTGCGTTCTTTCCCCT
Full Trace Sequence: ACGTGTAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCNAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTCAAATACAAAAACAGAGTCAGTCGGGGTCGATCTCCTTTGCGGGGTTAAAAGTACTCGGCTGAGTGGTTTATCTATGGTGCGGCCGAGGCCGGAGTTGCCGTGGGAGGAGGAGTCTGTCCGTCCGTAGGGGGAGGCGGCTGCTGCGGTGGTTGTGGGGGGGCCGGGATACATGCCGTTAGGTGCCATGGGTGGGCGTGATCCCATCATAGTGCCAGGCATATTGGGCATACCAGAAGGAGGTGGATGAATATTGGGCATCATGCGGCCTGGCATGGGAGGTCCAGTCATCATGGAACTTGGCCCTGGCATCTGACCTGGCTGTGAGGGGTGAGGAGGAGGCATCTGCTGGTGAACCCCATAAGGGGGAGGCTGCTGCTGTGCTTGGTGCCCCATCATTCCAGGAAGATTAGGGGCTCCTATATGCCCCATATTGGACCCTGCAGGCCCCCCTTGGAGTTGAGTGTTCTGGCTGTGTTGTTGTTGTTGCTGCTGCTGCTGCTGCTGTTCCAGTTGCTGTCTGGCTCTCATCTCAGCATATTTCAGCTGTTCCATGTGAAAGTTCTGGCGCTCATTAAGAAGCTGTTGCCTCTGTTGTTCCAGTGCTTCCTTTTCTCTGGTCATGATGGTCTCAAGTTCTTCAAAATGCCTCAGCTTGATCTCTAGCTTCTTCATCTGATTTTCTAACCACAAAAGCCACCAGAAGACTTGATCTTTGCGTTCTTTCCCCT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTCAAATACAAAAACAGAGTCAGT