ORFeome > smarcd1 ORF1 – XORFeome v1.0

smarcd1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: smarcd1
Gene ID: 491108
Gene Page ID: 491103
ORF Xenbase ID: 17297559

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC128685
Original XGC clone length: 1524

Human orthology & disease relationships

NCBI Entrez ID: 6602
Ensembl gene IDs: ENSG00000066117
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 124900,125800,161800,182290,301000,313900,600652,603278,603622,605249,607841,608751,609322

Library Location

Plate ID: GDExl11083
Well Location: D12

Sequences - 5ʹ (forward) EST

Accession: JZ837437
dbEST ID: 79655139
Trimmed Sequence: ATGGCGGCGCGGGCTGGATTCCAATCATTGACCCCGGGGGGGTCCGGTTCAACGGCGGCTGCACTGGGTCCCGGGACCCCTGGCCCAGCAGTGAGAATGGGTCCCGCCCCCGGGCAGGGGATTTACCGTTCTCCAATGCCTGGAGCTGCTTACCCGAGACCCGGTATGCTGCCTGGCAGTCGAATGACTCCTCAGGGACCAGCGATGGACCCTCCTGATTATGGTGGAAGTCCAGCTGCTCGGCCAGGCATAGCCCAGTCAGGCATGGACCAGTCTCGGAAACGTCCTGCGCCTCAACAAATACAGCAGGTGCAACAGGCTGCTCAGAATAGGAACCATAGTGCTAAGAAAAAGAAAATGGCTGATAAGATACTACCTCAGAGGATTAGGGAACTGGTACCCGAATCCCACGCTTACATGGATCTGCTAGCGTTTGAGATAAAGCTGGATCAGACAATTATGAGGAAACGGCTTGATATTCAAGAAGCTTTGAAGAGACCAATAAAGCAAAAGAGAAAACTTCGCATATTCATTTCCTATACTTTCAACCCTGCAGAATCAGACCCAAAAAAAGAAAAGGGAACTGTTGCTTCATGTGAGCTGCCGGGTGAAGGGGCCGTCTCCCGTTAAGAAGCCGCACTGCTTAAAAAAAAATACCACCAAGCAAAAAAAAAAATTCTGCGTCCTTTTTTAATTTCCTTCGTTCATGAGTTGGAAAAAAAACAGGATAAGGGGGCGGGAGATCGACAAAGATAAAAACGGGCGCGGGGAGCGCGGACAACAACACCAAAAAAACAAAAGGGGGGTGAAGGGGTGAGAGGCGCCT
Full Trace Sequence: CGAGGGCCAAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGCGCGGGCTGGATTCCAATCATTGACCCCGGGGGGGTCCGGTTCAACGGCGGCTGCACTGGGTCCCGGGACCCCTGGCCCAGCAGTGAGAATGGGTCCCGCCCCCGGGCAGGGGATTTACCGTTCTCCAATGCCTGGAGCTGCTTACCCGAGACCCGGTATGCTGCCTGGCAGTCGAATGACTCCTCAGGGACCAGCGATGGACCCTCCTGATTATGGTGGAAGTCCAGCTGCTCGGCCAGGCATAGCCCAGTCAGGCATGGACCAGTCTCGGAAACGTCCTGCGCCTCAACAAATACAGCAGGTGCAACAGGCTGCTCAGAATAGGAACCATAGTGCTAAGAAAAAGAAAATGGCTGATAAGATACTACCTCAGAGGATTAGGGAACTGGTACCCGAATCCCACGCTTACATGGATCTGCTAGCGTTTGAGATAAAGCTGGATCAGACAATTATGAGGAAACGGCTTGATATTCAAGAAGCTTTGAAGAGACCAATAAAGCAAAAGAGAAAACTTCGCATATTCATTTCCTATACTTTCAACCCTGCAGAATCAGACCCAAAAAAAGAAAAGGGAACTGTTGCTTCATGTGAGCTGCCGGGTGAAGGGGCCGTCTCCCGTTAAGAAGCCGCACTGCTTAAAAAAAAATACCACCAAGCAAAAAAAAAAATTCTGCGTCCTTTTTTAATTTCCTTCGTTCATGAGTTGGAAAAAAAACAGGATAAGGGGGCGGGAGATCGACAAAGATAAAAACGGGCGCGGGGAGCGCGGACAACAACACCAAAAAAACAAAAGGGGGGTGAAGGGGTGAGAGGCGCCT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGCGCGGGCTGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ837436
dbEST ID: 79655138
Trimmed Sequence: TGTATTTCGGATCCCGAGAGCCTGTTCCAGCTCCTGACGTCTTTGCTGCACCTTGGAGTAGAAATACCGGCATACAGCCTCATGAGCCCATGGTTGGAAGTAAAAATCAGCTCGACGTTCTTCTTCAGGATTACCCACCACATCAGTCATTGCTTTGAGGTCCCGGCACTGAGACTGTAACCAGTCATTAATAAATCCTTGAGGGTCACGGGCAAAGCTCAACATAAATTCCCTCTGAATCTTTAATTGATTGATAGTTTCAATTGTCTCGTGTATCTTGTTATCTAGAGCAGCTATCTCCTGCTGACTTGCGGTGGACAACAGAAAGGAGTTCATCTGAGTTTTTAAAGTATCATCAACTTCTACATCAATGTCATAACAAGCGGTTTTCTTCTGATCATTGGGGTCAGCACTAATGACATGATTGATTATAATTGGTTCTGGAGGGATGAGGAGAGCATGCAATCTCTGAGGGATCTCTAACAACTTCATCCTTTGATACCTCAATATCTGCTGCCAATATTTGTCACATATTATAAATTCCCCTTCATGAGGATCTTGGAAGTTGGTGAGTCTTGATGTACGGGCCCGCCGCCTTAAATTAATAAGTAGAGCAAAACTAAATTTGAGTGCGGTGGAACCGGAAGCGGCCGGCGAGTGGAGTGTAGACTATTAATGGGTGGGGGGTGGGGCAAAAAAAAAACATTTAAAAGCCCACGGTCCCAATCCCCCTTCGCCCCGGCCCCCGGGGGGCCCGGGGCAACGCCCCCA
Full Trace Sequence: AAAACTGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGTATTTCGGATCCCGAGAGCCTGTTCCAGCTCCTGACGTCTTTGCTGCACCTTGGAGTAGAAATACCGGCATACAGCCTCATGAGCCCATGGTTGGAAGTAAAAATCAGCTCGACGTTCTTCTTCAGGATTACCCACCACATCAGTCATTGCTTTGAGGTCCCGGCACTGAGACTGTAACCAGTCATTAATAAATCCTTGAGGGTCACGGGCAAAGCTCAACATAAATTCCCTCTGAATCTTTAATTGATTGATAGTTTCAATTGTCTCGTGTATCTTGTTATCTAGAGCAGCTATCTCCTGCTGACTTGCGGTGGACAACAGAAAGGAGTTCATCTGAGTTTTTAAAGTATCATCAACTTCTACATCAATGTCATAACAAGCGGTTTTCTTCTGATCATTGGGGTCAGCACTAATGACATGATTGATTATAATTGGTTCTGGAGGGATGAGGAGAGCATGCAATCTCTGAGGGATCTCTAACAACTTCATCCTTTGATACCTCAATATCTGCTGCCAATATTTGTCACATATTATAAATTCCCCTTCATGAGGATCTTGGAAGTTGGTGAGTCTTGATGTACGGGCCCGCCGCCTTAAATTAATAAGTAGAGCAAAACTAAATTTGAGTGCGGTGGAACCGGAAGCGGCCGGCGAGTGGAGTGTAGACTATTAATGGGTGGGGGGTGGGGCAAAAAAAAAACATTTAAAAGCCCACGGTCCCAATCCCCCTTCGCCCCGGCCCCCGGGGGGCCCGGGGCAACGCCCCCA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGTATTTCGGATCCCGAG