ORFeome > smek2 ORF1 – XORFeome v1.0

smek2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: smek2
Gene ID: 6256096
Gene Page ID: 1004660
ORF Xenbase ID: 17297631

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC045225
Original XGC clone length: 2463

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11013
Well Location: F11

Sequences - 5ʹ (forward) EST

Accession: JZ824094
dbEST ID: 79641796
Trimmed Sequence: ATGTCGGACACTAGACGCCGGGTGAAAGTCTACACTCTGAACGAAGACCGCCAGTGGGACGACAGGGGCACCGGGCACGTCTCGTCCACTTACGTAGAGCGACTGAAGGGAATGTCTCTGCTGGTTCGGGCAGAGTCTGACGGTTCCTTGCTTTTAGAATCCAAGATAAATCCGAACACTGCATATCAGAAGCAGCAGGATACTCTGATAGTTTGGTCTGAAGCAGAAAACTATGACTTGGCTCTCAGTTTTCAAGAAAAAGCTGGCTGTGATGAAATCTGGGAAAAAATATGCCAGGTTCAAGGTAAGGACCCATCTGTAGAAGTCACACAGGATCCTATTGATGAGTCTGAAGAAGAACGTTTTGAGGAGATGCCTGAAACTAGTAACTTAATCGATCTTCCTACATGTGAACTCGGTAAACTTGAAGAGATTGCTGACCTAGTTACCTCGGTACTTTCCTCGCCCATTCGTAGAGAGAAGCTAGCATTAGCCTTGGAAAATGAGGGCTACATCAAAAAACTGTTGCAACTCTTCCAAACCTGTGAAAACTTGGATAATACAGAAGGCTTGCACCATTTATATGAAATTATAAGAGGAATCTTATTTCTCAATAAAGCCGCGCTGTTTGAGGTGATGTTTTCGGACGAGTGTATTATGGATGTTGTAGGATGCTTAGAGTATGACCCAGCTTTGGCTCACCCGAAAAGACATCGGGAAATCTTGACCAAAACTGCAAAATTTAAGGAAGTTATACC
Full Trace Sequence: CCAGTAGTGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCGGACACTAGACGCCGGGTGAAAGTCTACACTCTGAACGAAGACCGCCAGTGGGACGACAGGGGCACCGGGCACGTCTCGTCCACTTACGTAGAGCGACTGAAGGGAATGTCTCTGCTGGTTCGGGCAGAGTCTGACGGTTCCTTGCTTTTAGAATCCAAGATAAATCCGAACACTGCATATCAGAAGCAGCAGGATACTCTGATAGTTTGGTCTGAAGCAGAAAACTATGACTTGGCTCTCAGTTTTCAAGAAAAAGCTGGCTGTGATGAAATCTGGGAAAAAATATGCCAGGTTCAAGGTAAGGACCCATCTGTAGAAGTCACACAGGATCCTATTGATGAGTCTGAAGAAGAACGTTTTGAGGAGATGCCTGAAACTAGTAACTTAATCGATCTTCCTACATGTGAACTCGGTAAACTTGAAGAGATTGCTGACCTAGTTACCTCGGTACTTTCCTCGCCCATTCGTAGAGAGAAGCTAGCATTAGCCTTGGAAAATGAGGGCTACATCAAAAAACTGTTGCAACTCTTCCAAACCTGTGAAAACTTGGATAATACAGAAGGCTTGCACCATTTATATGAAATTATAAGAGGAATCTTATTTCTCAATAAAGCCGCGCTGTTTGAGGTGATGTTTTCGGACGAGTGTATTATGGATGTTGTAGGATGCTTAGAGTATGACCCAGCTTTGGCTCACCCGAAAAGACATCGGGAAATCTTGACCAAAACTGCAAAATTTAAGGAAGTTATACC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCGGACACTAGACGC

Sequences - 3ʹ (reverse) EST

Accession: JZ829402
dbEST ID: 79647104
Trimmed Sequence: TGAACCGAGACGAGGTCTTTTTCTAGGGGATGCGTCTTCCTCCTCTTCTTCGTCTTCATCATCTGGATAATCCACTAGGCCGATAAGACTCCCCTTAGTAGATGCCACTGTAGTTGTCAGGCTTGTATTTTTGGAGGAAGATCCATTAGAAGTTGCTGGTGGTGTGTGAGCTGCCACAGACTTGCTGTTTGTACTATTTGCCCCATTAGCTGCACTAACCGAATGAGAGAAGGTGAATTTAAACGCTCCAACAGATGTCCTCTTTGGAAGATTTTCTTTATCTTCAAGCTCTTTCGCTTTTTTAGTTTCCAGAAATTTTTCATAACCTTCAGGAAAGTCATCCTCTGGTTTCGTTTTTTCCACGGGAGGTACGACTGCTTCCCCTTCCTCTTCATCATCTTCATTAAACCACAACTCTTCATCATCCTCCAGTGCTCTTGCATCCCTCCGAAATCTGTTACTGCGCAATATAGATGGTACGCTGCTTAGCTTCTGACTTTGACGATCCTTTTCTTGCTCATATCTAGTTTTCAGTCCTTTAAACGTTTGAACATATTCAATGGGTTCAAGTGCTTTATAAAAGTTTTCTACTATGTGTGATGTTAAAAATTTGATATTCTTCCACTCGTATAAATTCCAACAGGTTTAATTTATGGCAGAATTTTAAAAAAATTGTATCCTGGTTCCCTTTATTCCCGAAAGTGGCATTAAATAACGTGGGATCAAA
Full Trace Sequence: GGCTGCCAGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGAACCGAGACGAGGTCTTTTTCTAGGGGATGCGTCTTCCTCCTCTTCTTCGTCTTCATCATCTGGATAATCCACTAGGCCGATAAGACTCCCCTTAGTAGATGCCACTGTAGTTGTCAGGCTTGTATTTTTGGAGGAAGATCCATTAGAAGTTGCTGGTGGTGTGTGAGCTGCCACAGACTTGCTGTTTGTACTATTTGCCCCATTAGCTGCACTAACCGAATGAGAGAAGGTGAATTTAAACGCTCCAACAGATGTCCTCTTTGGAAGATTTTCTTTATCTTCAAGCTCTTTCGCTTTTTTAGTTTCCAGAAATTTTTCATAACCTTCAGGAAAGTCATCCTCTGGTTTCGTTTTTTCCACGGGAGGTACGACTGCTTCCCCTTCCTCTTCATCATCTTCATTAAACCACAACTCTTCATCATCCTCCAGTGCTCTTGCATCCCTCCGAAATCTGTTACTGCGCAATATAGATGGTACGCTGCTTAGCTTCTGACTTTGACGATCCTTTTCTTGCTCATATCTAGTTTTCAGTCCTTTAAACGTTTGAACATATTCAATGGGTTCAAGTGCTTTATAAAAGTTTTCTACTATGTGTGATGTTAAAAATTTGATATTCTTCCACTCGTATAAATTCCAACAGGTTTAATTTATGGCAGAATTTTAAAAAAATTGTATCCTGGTTCCCTTTATTCCCGAAAGTGGCATTAAATAACGTGGGATCAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGAACCGAGACGAGGTCTT