ORFeome > smg9 ORF1 – XORFeome v1.0

smg9 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: smg9
Gene ID: 990840
Gene Page ID: 990836
ORF Xenbase ID: 17297643

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123225
Original XGC clone length: 1527

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11088
Well Location: G11

Sequences - 5ʹ (forward) EST

Accession: JZ838212
dbEST ID: 79655914
Trimmed Sequence: ATGTCCGACTCAGGACACAGTCAGCCCAATGTGTTTATCCCTGGCCGCAACCGAAGGCGACGCTGGATGGACCAAGGACCGGCGGGAAACCTGAACCTGTCAGAGCCGGGACGAGAGAAAGACTCAGTGCTCCGGGACAGAGATCAGGAAAGATGGGAGGGGAATGATGAAGGCTGTGGCTACACAATTCAGAAAACGCCTATTATCCTCGCCAAGCCAGCCTCCGACAGGGCAAAGGCAGCAACCCCTGCGGCACCGGCTCCTATAGAAAAGCCCATTGTCCTGATGAAGGCCAGGGAAGAAGGAAAACCAACAGCCCCTGCAGAGGGCGCCGCCGTTCCCCCTGCTGCTGCAGTAGCCAAGGTAGAGAAAGAAGGACAGCGACCCACCCAACCAGTGTATCAAATACAGAACCGGGGCATGGGAGCTGCAGCAAGTGCCGGTGGCAGTGTGGATCCTGTTGTTGGTCAGGCCAAGCTGCTGCCTCCTCAGAAGATGAAACACAGCATCAAACTGGTGGATGAATACATGAACTGGTGTGACAGCGCTATTGAGTTCCTCCTGGACCAGACGGATGTGCTTGTAGTTGGGGTGCTAGGATTACNANGCACAGGAAAGTCCACCTTGATGTCCCTGTTATCAGCAAACTCTCCGGATGATGATCAAAGGTCTTACGTGTTCCGGATGCAAACCCAGGAAGTTAAGGGAAAAAACTGGGAAACCAGACTAACCGGCCTTGACCTTCTTTCTTACCCCGGGAAAAAAAATCATCCTTCCCCTTATTACCCAGCCCAAATTTCTCAACCCCC
Full Trace Sequence: CGCGGCCCATATAATAGATTTTATTTNTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCCGACTCAGGACACAGTCAGCCCAATGTGTTTATCCCTGGCCGCAACCGAAGGCGACGCTGGATGGACCAAGGACCGGCGGGAAACCTGAACCTGTCAGAGCCGGGACGAGAGAAAGACTCAGTGCTCCGGGACAGAGATCAGGAAAGATGGGAGGGGAATGATGAAGGCTGTGGCTACACAATTCAGAAAACGCCTATTATCCTCGCCAAGCCAGCCTCCGACAGGGCAAAGGCAGCAACCCCTGCGGCACCGGCTCCTATAGAAAAGCCCATTGTCCTGATGAAGGCCAGGGAAGAAGGAAAACCAACAGCCCCTGCAGAGGGCGCCGCCGTTCCCCCTGCTGCTGCAGTAGCCAAGGTAGAGAAAGAAGGACAGCGACCCACCCAACCAGTGTATCAAATACAGAACCGGGGCATGGGAGCTGCAGCAAGTGCCGGTGGCAGTGTGGATCCTGTTGTTGGTCAGGCCAAGCTGCTGCCTCCTCAGAAGATGAAACACAGCATCAAACTGGTGGATGAATACATGAACTGGTGTGACAGCGCTATTGAGTTCCTCCTGGACCAGACGGATGTGCTTGTAGTTGGGGTGCTAGGATTACNANGCACAGGAAAGTCCACCTTGATGTCCCTGTTATCAGCAAACTCTCCGGATGATGATCAAAGGTCTTACGTGTTCCGGATGCAAACCCAGGAAGTTAAGGGAAAAAACTGGGAAACCAGACTAACCGGCCTTGACCTTCTTTCTTACCCCGGGAAAAAAAATCATCCTTCCCCTTATTACCCAGCCCAAATTTCTCAACCCCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCCGACTCAGGACAC

Sequences - 3ʹ (reverse) EST

Accession: JZ838211
dbEST ID: 79655913
Trimmed Sequence: GCCCAGTAACCTGCTGTACTCTGAAAGTGCTGATGACTTCTTTACACCATCCCAAATCCGGGCAGCATAGTGGAACCAGTTCTTTTCGGTCAGGATGGTGTGAGAGAGTTGAGGGCGTGACATGGACATGATCTGGCTGCGCAGTCTGCTGACGAGGGAATGGAAGCTGGGGTGCCCCTTGTATGCCGGCAGGAGGGAGAACAGGGGGATTCCACTGGTGCCTGCCCTGGATATGGTCTCATCAGCGTCACTCTCCATGGTTGGGATGAGGAATAAGTTCACTTCTGACTCAACAAAGTCATAGGGCAGACCTGGGAAGATGTTGCAGTCCAGCATGGAAAGGGTGCCTTTGTATCTCAGGTGTGAATGGAGCATTAGTTTATCCATAACCGTGTGCATCTGCTTCAAAGTGCGGGGGCAGAAATCTTCTCTCTTGGATTTATTCTGCACAAAAACTATGTGTGGATAATACTCAATGCCTTCATCTGAGCCAGAGGAGCCACTTGACTCATGACTGGGAGAGGGAGTCGATGGCTTCAGCATTTCGGCTGTCTGAAGAAAGCGGTATAAATTGAAGTCTGTGAAACAATCCTGTACAACGATGAACACATGACAAACTGTGAACAAAAGGCAGCAATTTGTAGAACTGCTCTCACGTAGTGGGTTTGGGGAAAAAATGATTTTCGGGGGGGCCATTTTTCGGTCGTTAATAATCAAAATTAACCCATTAATTCCCTGGGCCTAAAAATAAGGCCTGGGGTAAAAC
Full Trace Sequence: GGCACCATGGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCCCAGTAACCTGCTGTACTCTGAAAGTGCTGATGACTTCTTTACACCATCCCAAATCCGGGCAGCATAGTGGAACCAGTTCTTTTCGGTCAGGATGGTGTGAGAGAGTTGAGGGCGTGACATGGACATGATCTGGCTGCGCAGTCTGCTGACGAGGGAATGGAAGCTGGGGTGCCCCTTGTATGCCGGCAGGAGGGAGAACAGGGGGATTCCACTGGTGCCTGCCCTGGATATGGTCTCATCAGCGTCACTCTCCATGGTTGGGATGAGGAATAAGTTCACTTCTGACTCAACAAAGTCATAGGGCAGACCTGGGAAGATGTTGCAGTCCAGCATGGAAAGGGTGCCTTTGTATCTCAGGTGTGAATGGAGCATTAGTTTATCCATAACCGTGTGCATCTGCTTCAAAGTGCGGGGGCAGAAATCTTCTCTCTTGGATTTATTCTGCACAAAAACTATGTGTGGATAATACTCAATGCCTTCATCTGAGCCAGAGGAGCCACTTGACTCATGACTGGGAGAGGGAGTCGATGGCTTCAGCATTTCGGCTGTCTGAAGAAAGCGGTATAAATTGAAGTCTGTGAAACAATCCTGTACAACGATGAACACATGACAAACTGTGAACAAAAGGCAGCAATTTGTAGAACTGCTCTCACGTAGTGGGTTTGGGGAAAAAATGATTTTCGGGGGGGCCATTTTTCGGTCGTTAATAATCAAAATTAACCCATTAATTCCCTGGGCCTAAAAATAAGGCCTGGGGTAAAAC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCCCAGTAACCTGCTGTA