ORFeome > smim12 ORF2 – XORFeome v1.0

smim12 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: smim12
Gene ID: 6255874
Gene Page ID: 5841152
ORF Xenbase ID: 17297655

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129636
Original XGC clone length: 276

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11086
Well Location: F04

Sequences - 5ʹ (forward) EST

Accession: JZ837890
dbEST ID: 79655592
Trimmed Sequence: ATGTGGCCTGTCCTGTGGGCAGCAGCGAGGACCTACGCTCCTTACATTACTTTTCCTGTGGCATTTGTAGTTGGAGCAGTTGGTTACCAACTAGAATGGTTCATTCGTGGGACCCCAGAGCATCCGGTGGAAGAACAGAGTATTCAAGAAAAAAGAGAGGAGAGGACTCTGCAAGAGACTATGGGAAAGGATGTTACACAGGTTATAAGTCTAAAGGAGAAGCTGGAATTCACACCAAAAGCTGTACTGAACCGCAATCGACAAGAGAAGAGTTT
Full Trace Sequence: GGGGTCTAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTGGCCTGTCCTGTGGGCAGCAGCGAGGACCTACGCTCCTTACATTACTTTTCCTGTGGCATTTGTAGTTGGAGCAGTTGGTTACCAACTAGAATGGTTCATTCGTGGGACCCCAGAGCATCCGGTGGAAGAACAGAGTATTCAAGAAAAAAGAGAGGAGAGGACTCTGCAAGAGACTATGGGAAAGGATGTTACACAGGTTATAAGTCTAAAGGAGAAGCTGGAATTCACACCAAAAGCTGTACTGAACCGCAATCGACAAGAGAAGAGTTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCACCTCTGGGCAAAAAAAAAAAAAAAAAAAAAATACAAAACCCCCCCTCCCACCCCAAAAGACAAAAAAAAAAAATAATCTTCCTCCCCGCGTTGGTGGGTTTTCCGATTTTTAGCTAAGAAACCCCACCAACCGAAAATACCCCTGGTTGCTTATTTGTTTAAAAAAAATACACCCCCGACCCCCGGCACAAAACCCTCGGGCCGCCGCGAGAGGGGGGAGGGCGGGTGTTGTTTTGTTTTCTTTTTTTTTGTTTTTATTATTCTTTTACAACCCCCCCCCCCGGACACAACCCCCCCCGCGGGGGGCGTTTTTTTTTTTTTTTTTATTATTTAATTAATTTTATTTTTTTGGGGGGGCAAN
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTGGCCTGTCCTGTG

Sequences - 3ʹ (reverse) EST

Accession: JZ837889
dbEST ID: 79655591
Trimmed Sequence: ACTCTTCTCTTGTCGATTGCGGTTCAGTACAGCTTTTGGTGTGAATTCCAGCTTCTCCTTTAGACTTATAACCTGTGTAACATCCTTTCCCATAGTCTCTTGCAGAGTCCTCTCCTCTCTTTTTTCTTGAATACTCTGTTCTTCCACCGGATGCTCTGGGGTCCCACGAATGAACCATTCTAGTTGGTAACCAACTGCTCCAACTACCAATGCCACATGAAAAGTAATGTAAGGAGCGTACGTCCTCGCTGCTGCCCACAGGACAGGCCACATGG
Full Trace Sequence: GGGGCGGGTAAACAGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAAAAAGTTGGCAAACTCTTCTCTTGTCGATTGCGGTTCAGTACAGCTTTTGGTGTGAATTCCAGCTTCTCCTTTAGACTTATAACCTGTGTAACATCCTTTCCCATAGTCTCTTGCAGAGTCCTCTCCTCTCTTTTTTCTTGAATACTCTGTTCTTCCACCGGATGCTCTGGGGTCCCACGAATGAACCATTCTAGTTGGTAACCAACTGCTCCAACTACCAATGCCACATGAAAAGTAATGTAAGGAGCGTACGTCCTCGCTGCTGCCCACAGGACAGGCCACATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCATTCAAAATAAAATCATTATTTGGGGCCCGAGCTTAATATTGGCCGAAAAAAAAAAAACATAGAAAATGATAACTGAGGTTCGGGGAACAAAAGGGGACAAAAAAAAAAAGATCTGTGATCACAAGGGGCTGTGGGGATGATATGTATTAGAGGTTGGGAGCAGACAAGCAGGGGCAAAACTCTTGGTGGGGTGTGGGCGGGTAGGGGACCCCGGGGGGGAGAGACCCCCGGCCGGAAAAAAATAGAAAAAGAAGAGGGGGAAGGGCGGGGGGGGGTTTTGGCAAGTTTTATTAAAATTTTTGGGGGGAGAAAGCAGGCCGGGGGCNCNCAAGGGGGGGGGGNAGAGGGTGTGGGGTGTTGNGGGTTGAAANGNCNGGAAAGANGAGGGGGAGGGGGNNGGGGGAGAGGGAGGGGGNGAGGGGGGAAGGGGNAGGAGGGGAGGAGANNANGGGGGNNGGGGGNGGTNANTGAGAAGGNGGNNGNGAGGGNGGAAAGGGGGGGAGGNAANAGGGAGGGGNAANNNNNNNNNNNNNNNANNNNNNNNNNNNNNANNNNNNNNNNNNNNNNTANNANNNNNANNNNNNNNAATNNNANTANNNNANNNNANNNNNNNNNNNNNATNNNNNNTATNTNANNNTNNTATNNNNNNNAAAAANAANNAANNANNTNNNAAATNNNNNANTAAAAAAAGGGGGGTGGAAGGGGGTGGAGGGGTGGGTGGGNAGGGGGTGAGGGNGGGGGGGGCGGTGGGGGGGGGGGAGGGGGGNGGAGGGGGGNGTGGGGNAAGGNATAGGGGNTGAAGTGAGNGNGNGAGAGGGGNAGGGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACTCTTCTCTTGTCGATTGCGGTT