ORFeome > smpd4 ORF1 – XORFeome v1.0

smpd4 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: smpd4
Gene ID: 962471
Gene Page ID: 962466
ORF Xenbase ID: 17297691

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC097653
Original XGC clone length: 2391

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11073
Well Location: H06

Sequences - 5ʹ (forward) EST

Accession: JZ835517
dbEST ID: 79653219
Trimmed Sequence: ATGCTACTTGCTGGCGGGAGTCCGCAGCCCAGTTTTCTGCTGGGATCACTGAAGGCTGATTGTGTAACCAAGCCGTTTTTACAGAGGTGTCAGGACCTCGTTCGAGTCATAGAGGATTTCCCTGCTAAGGAGCTTCATGCTATTTTTCCATGGCTAATAGAAACAGTCTTTGGCAGTCTGGATGGAAGTATACTGGGTTGGAACCTCCGTGGCTTACATGAGCGTATCAATCCACTGGAATTTCATACTGCCTTGGAATTTTTGGATCCAAGTGGAGCAATGATGAAGTTGGTTTATAAGCTGCAGGCTGAAGAATACAAATATGATTTTCCTGTCTCCTTCCTTCCAGGCCCAGTCAGAGCATCAATACAAGAGCGAGTGCTCCCTGAATGCCCCTTGTATCATAACAAGATCCAGTTCCCAGCCTCAGGAGGGGTCAGCTTTAATCTTGCTTTGAATTCCTTTGAATATTTCATGTTCCACTTTGCCTTCTGCCTCCTTAAACAAAGAAATTATCCCCAAGGTCTTCACTTTAGCACTGCAGACAGCGCGTATTACATTTTGGTTGACAAGTACCTGAAATGGTTCCTGCCTGTTGAAGGGAATGTCCCACCTCCCCATTCACCAAACACAGGAGGGACTGTACCCTCACCAGCCCCCAGATCCCCATCACTTTCGTTCACCTCTTATGGGTCTCACACAAAGTCTTTAAAGAGACACATTTCTCACCAACATCCTTGTAATGCTGGACCTGCAGCAAAGGGAAAAATGGCGGAACGAAAACCTTTAAGGCAAATAATTTGTGAAAAGAAAAGGGGC
Full Trace Sequence: GTGTTCATGGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCTACTTGCTGGCGGGAGTCCGCAGCCCAGTTTTCTGCTGGGATCACTGAAGGCTGATTGTGTAACCAAGCCGTTTTTACAGAGGTGTCAGGACCTCGTTCGAGTCATAGAGGATTTCCCTGCTAAGGAGCTTCATGCTATTTTTCCATGGCTAATAGAAACAGTCTTTGGCAGTCTGGATGGAAGTATACTGGGTTGGAACCTCCGTGGCTTACATGAGCGTATCAATCCACTGGAATTTCATACTGCCTTGGAATTTTTGGATCCAAGTGGAGCAATGATGAAGTTGGTTTATAAGCTGCAGGCTGAAGAATACAAATATGATTTTCCTGTCTCCTTCCTTCCAGGCCCAGTCAGAGCATCAATACAAGAGCGAGTGCTCCCTGAATGCCCCTTGTATCATAACAAGATCCAGTTCCCAGCCTCAGGAGGGGTCAGCTTTAATCTTGCTTTGAATTCCTTTGAATATTTCATGTTCCACTTTGCCTTCTGCCTCCTTAAACAAAGAAATTATCCCCAAGGTCTTCACTTTAGCACTGCAGACAGCGCGTATTACATTTTGGTTGACAAGTACCTGAAATGGTTCCTGCCTGTTGAAGGGAATGTCCCACCTCCCCATTCACCAAACACAGGAGGGACTGTACCCTCACCAGCCCCCAGATCCCCATCACTTTCGTTCACCTCTTATGGGTCTCACACAAAGTCTTTAAAGAGACACATTTCTCACCAACATCCTTGTAATGCTGGACCTGCAGCAAAGGGAAAAATGGCGGAACGAAAACCTTTAAGGCAAATAATTTGTGAAAAGAAAAGGGGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCTACTTGCTGGCGGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ835518
dbEST ID: 79653220
Trimmed Sequence: GTTATTGTGTGGTTTCTGCTCTTCAGAGAGCAGCGTTTGGACAATAGCATAAAACATGCAGCCAATTAAGAGGAGAAATGTGCAGATTAAAGGCCCCAGAGACAGCAAGGAGCCCAGAATGTAAAAGATGAACAAAAAGGCCAGAGTGCGATAGCTAGCGAGGAACCGTAGGCGGATGTGTGGGGCTGCTGGCTCAGAGGGAGAAACTGAAGTTATGGGGCTTTTTTTGCATTTCCGGGAAGAGCTGGTCAGGTGATGTCGGCAAAGCTTGCCTAAAAAATCCTTCCGAGCGCACAGGGCACCCATGCTATTTGCAAACCTTTTATTTATCACACTTGAAAGCCGATAGAGGTAACGTACAAGCATGGCATTCTCATAGCTTCTGATTGGCTGGAGCTCAGGGTCTCCTTGGTACTCTATATCAAACTTGCGCAATCCATTTATTATCTGGTACCTTCCTAAGGAGGTGAGGACCACACCATCTTCACTTTGTATACAGTCAGGCAGTTTATTCTTTCCATCATCATCCTGCGAGCTGTCAACATTTGCTGTAAGTTGCCCAAGTTGAGTGGGGTTCAGCCTAAATATCTGACAAAAGTAGTCCAGTGCTTTTTCTAAATGTTCATCTGTCTTCCTAATGGTGTCATATCCAGCTTTCATCCAAATCACTCCCCATTGTAGGAGCCATTTAAAATCCTGGGGGAACCCAAATCCAAACCAAAAACAAGAAAAGACTGAATTTGCAGGAGAAAAATCTGGGGTAAAAGG
Full Trace Sequence: AGGGAAATCAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTTATTGTGTGGTTTCTGCTCTTCAGAGAGCAGCGTTTGGACAATAGCATAAAACATGCAGCCAATTAAGAGGAGAAATGTGCAGATTAAAGGCCCCAGAGACAGCAAGGAGCCCAGAATGTAAAAGATGAACAAAAAGGCCAGAGTGCGATAGCTAGCGAGGAACCGTAGGCGGATGTGTGGGGCTGCTGGCTCAGAGGGAGAAACTGAAGTTATGGGGCTTTTTTTGCATTTCCGGGAAGAGCTGGTCAGGTGATGTCGGCAAAGCTTGCCTAAAAAATCCTTCCGAGCGCACAGGGCACCCATGCTATTTGCAAACCTTTTATTTATCACACTTGAAAGCCGATAGAGGTAACGTACAAGCATGGCATTCTCATAGCTTCTGATTGGCTGGAGCTCAGGGTCTCCTTGGTACTCTATATCAAACTTGCGCAATCCATTTATTATCTGGTACCTTCCTAAGGAGGTGAGGACCACACCATCTTCACTTTGTATACAGTCAGGCAGTTTATTCTTTCCATCATCATCCTGCGAGCTGTCAACATTTGCTGTAAGTTGCCCAAGTTGAGTGGGGTTCAGCCTAAATATCTGACAAAAGTAGTCCAGTGCTTTTTCTAAATGTTCATCTGTCTTCCTAATGGTGTCATATCCAGCTTTCATCCAAATCACTCCCCATTGTAGGAGCCATTTAAAATCCTGGGGGAACCCAAATCCAAACCAAAAACAAGAAAAGACTGAATTTGCAGGAGAAAAATCTGGGGTAAAAGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTTATTGTGTGGTTTCTGCTCT