ORFeome > smpx ORF1 – XORFeome v1.0

smpx ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: smpx
Gene ID: 865935
Gene Page ID: 490114
ORF Xenbase ID: 17297697

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC053754
Original XGC clone length: 276

Human orthology & disease relationships

NCBI Entrez ID: 23676
Ensembl gene IDs: ENSG00000091482
Directly associated (OMIM) disease MIM numbers: 300066
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11001
Well Location: B10

Sequences - 5ʹ (forward) EST

Accession: JZ839124
dbEST ID: 79656826
Trimmed Sequence: ATGTCTAAGCAGCCGGCATCCAATATCAGATCTATTCAGGCTAATATCAATATTCCTATGGGGGCATTTCGACCTGGTGCCGGCCAGCCACCCAAAAGAAAAGAATTTTCAACTGAAGAAGAGCAGCATGTCCCAACGCCAGAATCTGAAGAAAAGAGTGAAGAAAAGAAACCTATTCCAGGAGCAGTAAAACTTCCAGGGCCGGCGTTCAACCTCTCAGAAATCCAGAATGTAAAAAGTGTACTTAAATTTGTACCAAAAGCAAAGGAACAATT
Full Trace Sequence: GGGGGGCTCTAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCTAAGCAGCCGGCATCCAATATCAGATCTATTCAGGCTAATATCAATATTCCTATGGGGGCATTTCGACCTGGTGCCGGCCAGCCACCCAAAAGAAAAGAATTTTCAACTGAAGAAGAGCAGCATGTCCCAACGCCAGAATCTGAAGAAAAGAGTGAAGAAAAGAAACCTATTCCAGGAGCAGTAAAACTTCCAGGGCCGGCGTTCAACCTCTCAGAAATCCAGAATGTAAAAAGTGTACTTAAATTTGTACCAAAAGCAAAGGAACAATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCAAAGTCTAAAAATCTCAGATGTAACATAAAGGCCTTTNTGGGCAAAAAAAAAAAAAAAATAAAAATTATGACTTCCCCCAGCTTGGGGGGCGCATTGTATTGGTTTCTTTGAATTGTAGCCCCCCCGGAGAAAAACCAGTGTGTGCCCAAACTGTGTAAACTGGTAAAAAGACACCCACCCAGGGGGGCACACAACCCGTCCCGGAGCCCAAGACGGAGGGAAACGACAGAGAAGATTTTGTGCCTCTCTCGCAAATGGTTCTTTAAAAAATTAACCCTAAAAACCACCCGAGAGGGACACAAGGACCAGCGGGGGGCCGAGTTTATTATGGTGATTTATAATAAAAANATAATAATTAATT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTAAGCAGCCGGCATCCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ839123
dbEST ID: 79656825
Trimmed Sequence: TTGTTCCTCTGCTTTTGGTACAAATTTAAGTACACTTTTTACATTCTGGATTTCTGAAAGGTTGAACGCCGGCCCTGGAAGTTTTACTGCTCCTGGAATAGGTTTCTTTTCTTCACTCTTTTCTTCAAATTCTGGCGTTGGGACATGCTGCTCTTCTTCAGTTGAAAATTCTTTTCTTTTGGGTGGCTGGCCGGCACCAGGTCAAAATGCCCCCATAGGAATATTGATATTAGCCTGAATAGATCTAATATTGGATGCCGGCTGCTTAAACATGG
Full Trace Sequence: GGGGAAACAGGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTGTTCCTCTGCTTTTGGTACAAATTTAAGTACACTTTTTACATTCTGGATTTCTGAAAGGTTGAACGCCGGCCCTGGAAGTTTTACTGCTCCTGGAATAGGTTTCTTTTCTTCACTCTTTTCTTCAAATTCTGGCGTTGGGACATGCTGCTCTTCTTCAGTTGAAAATTCTTTTCTTTTGGGTGGCTGGCCGGCACCAGGTCAAAATGCCCCCATAGGAATATTGATATTAGCCTGAATAGATCTAATATTGGATGCCGGCTGCTTAAACATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCATTCAAAATAAAATCATTATTTGGGGCCCGACCTTAATACAAAAAAAAATAAAAAAACATATAAACTGTGCTCCCCCCGTAAAGAAAAAGGAAAAAAAAAAAAGAAAATAGCGTCTCACCAGGGGGGGGGGGGCTTTGCTTGTGTTTTATGGAAAGAAAACCCCCTACAGAAAACACACCCGCCCCGTTGGGTGTTAATGAGAGAGGAACCCCGACCCCCGCCCCGCCCCANGCGCACACCCCGGCGGGGGGGGAGAGGGGGGGCGGGTTGGAGTATTTTGATTTTTGGACTTTTTTAATAACAGAGCGCCCCGGCATCACGGACTGAGCCACGGCATGAGTAAAGGAAGTGATTTTTCTNTGTCGGTGGTTTTTCTTNTNTGAAGGCCAGAAGGGGGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTGTTCCTCTGCTTTTGGTACA