ORFeome > smyd2 ORF1 – XORFeome v1.0

smyd2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: smyd2
Gene ID: 985586
Gene Page ID: 985582
ORF Xenbase ID: 17297733

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC044103
Original XGC clone length: 1293

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11009
Well Location: H09

Sequences - 5ʹ (forward) EST

Accession: JZ823732
dbEST ID: 79641434
Trimmed Sequence: ATGGGACAGCCCGAGGGTCTGGAACGGTTCGACAGCCCAGGGAAAGGCCGGGGACTGAAGGCGACGCGTTCCTTCGCGCTGGGGGAGCTGCTGTTCACCTGCCCGGCCTACACCTACGTACTGACTGACACCGAGCGGGGCAACCACTGCGACTTCTGCTTCGCCAGGAAGGAAGGTTTATCGAAATGCGGCAAATGCAAGCAAGCCTTTTACTGCAACGTGGACTGCCAGAAAGGAGACTGGCCCATGCACAAGTTGGAATGTTCGGCCATGTGTTCTTATGGACAGAACTGGTGTCCCTCGGAAACCGTCAGGCTCACGGCGAGGATACTGGCCAAACAGAAAACCCAGACAGAGAGGACACCGTCGGAAACGTTCCTCTCGGTTAAAGAGTTTGAATCCCACCTCAGCAAGCTTGACAACGAGAAGAAAGAGTTAATTGAGAGTGACATTGCTGCCTTGCACCGTTTTTACTCCAAGAATTTGCACTATACCGACAATGCGGCACTAGTGTTCCTCTTTGCACAGGTAAACTGCAACGGCTTCACCATTGAAGATGAAGAACTCTCCCATTTGGGATCCGCCATATTCCCAGATGTTGCGCTGATGAATCACAGCTGCTGCCCCAACATCATCGTCACGTTCAAGGGAACAGTGGCCGAAATCAGAGCCGTGNCAGAGATCCACGCCGGGGGACGAGGTTTTCACCAGTTTACATGATCTGCTCTACCCCACGGAGGATCGAAACGACAGACTGATGGATTTCCTATTTCTTTACC
Full Trace Sequence: CATTATTGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGACAGCCCGAGGGTCTGGAACGGTTCGACAGCCCAGGGAAAGGCCGGGGACTGAAGGCGACGCGTTCCTTCGCGCTGGGGGAGCTGCTGTTCACCTGCCCGGCCTACACCTACGTACTGACTGACACCGAGCGGGGCAACCACTGCGACTTCTGCTTCGCCAGGAAGGAAGGTTTATCGAAATGCGGCAAATGCAAGCAAGCCTTTTACTGCAACGTGGACTGCCAGAAAGGAGACTGGCCCATGCACAAGTTGGAATGTTCGGCCATGTGTTCTTATGGACAGAACTGGTGTCCCTCGGAAACCGTCAGGCTCACGGCGAGGATACTGGCCAAACAGAAAACCCAGACAGAGAGGACACCGTCGGAAACGTTCCTCTCGGTTAAAGAGTTTGAATCCCACCTCAGCAAGCTTGACAACGAGAAGAAAGAGTTAATTGAGAGTGACATTGCTGCCTTGCACCGTTTTTACTCCAAGAATTTGCACTATACCGACAATGCGGCACTAGTGTTCCTCTTTGCACAGGTAAACTGCAACGGCTTCACCATTGAAGATGAAGAACTCTCCCATTTGGGATCCGCCATATTCCCAGATGTTGCGCTGATGAATCACAGCTGCTGCCCCAACATCATCGTCACGTTCAAGGGAACAGTGGCCGAAATCAGAGCCGTGNCAGAGATCCACGCCGGGGGACGAGGTTTTCACCAGTTTACATGATCTGCTCTACCCCACGGAGGATCGAAACGACAGACTGATGGATTTCCTATTTCTTTACC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGACAGCCCGAGGGT

Sequences - 3ʹ (reverse) EST

Accession: JZ829041
dbEST ID: 79646743
Trimmed Sequence: CAGCTCCAATTCCTTCTTGATCTCGGCAATATAATGATGATCAGGACCATGGGCTATTTGCATTATAGCCAGCGCCTTCTTCAGAGCCTTTGTCCCAATAGTTGTCTTTTCCAGGCCCATATACAGGCGGCCCAGCTTCAGCCACATGGAGGCCACATTCAGGGAATATGCGGGATAGTGCTTACTGTAGGGTTTGATAATTTTCTCTCCGTACTTTAAGGCTCCGTCCCACTCCTGCAAGTACAGACACACGCCCATTGCCTGGTACATCATATGTAACATGTACACGTTGCTGTCCACAAACACAGAGCCCATCTTATCCAGACTCAGCTCACACATCTCCAGCAGCTCACTGGGAGTCTTATAGTGCTTTGCTCTCCGGAACTCCTCGACGATGTTGCGTGCATATTTGATCATGTCTTTCACTGTCTGGTGGCTCGGAGGGTCGCTCAGTTTTCGGATTTCCAATTTTGCCGGATCCTTCTGTTTAGTGGAGCACTCTCTGCAGTCACAGGTAAAGAAATAGGAATCCATCAGTCTGTCGTTTCGATCCTCCGTGGGGTAGAGCAGATCAATGTAACTGGTGAAAACCTCGTCCCCGGCGTGGATCTCTTGCACGGCTCTGATTTCGGCCACTGTTCCCTTGAACGTGACGATGATGTTGGGGGCAGCAGCTGTGAATCATCAGCGCAACATCTGGGAATATGGCGGAATCCCAAATGGGAAAAGTTCCTTCATCCTTCCAAGGGTGAAAACCCGTTTT
Full Trace Sequence: ACGGGAAATCAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACAGCTCCAATTCCTTCTTGATCTCGGCAATATAATGATGATCAGGACCATGGGCTATTTGCATTATAGCCAGCGCCTTCTTCAGAGCCTTTGTCCCAATAGTTGTCTTTTCCAGGCCCATATACAGGCGGCCCAGCTTCAGCCACATGGAGGCCACATTCAGGGAATATGCGGGATAGTGCTTACTGTAGGGTTTGATAATTTTCTCTCCGTACTTTAAGGCTCCGTCCCACTCCTGCAAGTACAGACACACGCCCATTGCCTGGTACATCATATGTAACATGTACACGTTGCTGTCCACAAACACAGAGCCCATCTTATCCAGACTCAGCTCACACATCTCCAGCAGCTCACTGGGAGTCTTATAGTGCTTTGCTCTCCGGAACTCCTCGACGATGTTGCGTGCATATTTGATCATGTCTTTCACTGTCTGGTGGCTCGGAGGGTCGCTCAGTTTTCGGATTTCCAATTTTGCCGGATCCTTCTGTTTAGTGGAGCACTCTCTGCAGTCACAGGTAAAGAAATAGGAATCCATCAGTCTGTCGTTTCGATCCTCCGTGGGGTAGAGCAGATCAATGTAACTGGTGAAAACCTCGTCCCCGGCGTGGATCTCTTGCACGGCTCTGATTTCGGCCACTGTTCCCTTGAACGTGACGATGATGTTGGGGGCAGCAGCTGTGAATCATCAGCGCAACATCTGGGAATATGGCGGAATCCCAAATGGGAAAAGTTCCTTCATCCTTCCAAGGGTGAAAACCCGTTTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAGCTCCAATTCCTTCTTGAT