ORFeome > snai1 ORF1 – XORFeome v1.0

snai1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: snai1
Gene ID: 865328
Gene Page ID: 479969
ORF Xenbase ID: 17297745

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC056857
Original XGC clone length: 780

Human orthology & disease relationships

NCBI Entrez ID: 6615
Ensembl gene IDs: ENSG00000124216
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 101600,123500,131300,147950,154705,600376,609192

Library Location

Plate ID: GDExl11002
Well Location: F11

Sequences - 5ʹ (forward) EST

Accession: JZ839287
dbEST ID: 79656989
Trimmed Sequence: ATGCCCCGGTCATTTCTGGTCAAGAAACATTTCTCTGCCAGCAAGAAGCCCAACTACAGCGAGCTGGAGAGTCAGACAGTGTATATATCACCGTTCATCTATGACAAGTTTCCTGTGATCCCCCAGCCAGAGATTTTAAGCACAGGGGCTTACTACACACCTCTTGTCTGGGACACTGGTTTACTCACCACATTTTTCACCTCTGAGTCCGACTACAAAAAGTCTCCCATCAGCCCTTCCAGCAGCGACGATTCCTCCAAGCCCTTAGACCTCACGTCCTTCTCCAGCGAAGATGAAGGGGGCAAGACTTCGGACCCTCCCAGCCCCGCTTCATCCGCCACGGAAGCGGAGAAATTTCAATGCAATCTGTGCAGCAAGTCTTACTCCACCTTTGCCGGACTTTCCAAGCACAAACAGTTGCACTGTGACTCCCAGACGAGGAAGTCGTTCAGTTGCAAATACTGCGAGAAGGAGTACGTCAGCTTGGGTGCCTTAAAAATGCACATCCGGAGCCACACGCTGCCCTGCGTCTGTAAAATCTGCGGCAAAGCCTTCTCCAGACCGTGGTTATTACAGGGACACATCAGAACACACACAGGAGAGAAGCCATTTTCCTGTACTCACTGCAACCGTGCCTTCGCCGACCGCTCCAATCTCCGAGCCCACCTGCAAACCCCTTCCAACGTCAAAAAGTACCAGTGCAAAACCTGCTCCTGGACCTTTTCTCCGAAAGGTCCCTTCCTTCCCAAACCACAAGGAAAAACCGGGTGGCACGGGGGGGCCCCCCTTGGC
Full Trace Sequence: GCTCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCCCGGTCATTTCTGGTCAAGAAACATTTCTCTGCCAGCAAGAAGCCCAACTACAGCGAGCTGGAGAGTCAGACAGTGTATATATCACCGTTCATCTATGACAAGTTTCCTGTGATCCCCCAGCCAGAGATTTTAAGCACAGGGGCTTACTACACACCTCTTGTCTGGGACACTGGTTTACTCACCACATTTTTCACCTCTGAGTCCGACTACAAAAAGTCTCCCATCAGCCCTTCCAGCAGCGACGATTCCTCCAAGCCCTTAGACCTCACGTCCTTCTCCAGCGAAGATGAAGGGGGCAAGACTTCGGACCCTCCCAGCCCCGCTTCATCCGCCACGGAAGCGGAGAAATTTCAATGCAATCTGTGCAGCAAGTCTTACTCCACCTTTGCCGGACTTTCCAAGCACAAACAGTTGCACTGTGACTCCCAGACGAGGAAGTCGTTCAGTTGCAAATACTGCGAGAAGGAGTACGTCAGCTTGGGTGCCTTAAAAATGCACATCCGGAGCCACACGCTGCCCTGCGTCTGTAAAATCTGCGGCAAAGCCTTCTCCAGACCGTGGTTATTACAGGGACACATCAGAACACACACAGGAGAGAAGCCATTTTCCTGTACTCACTGCAACCGTGCCTTCGCCGACCGCTCCAATCTCCGAGCCCACCTGCAAACCCCTTCCAACGTCAAAAAGTACCAGTGCAAAACCTGCTCCTGGACCTTTTCTCCGAAAGGTCCCTTCCTTCCCAAACCACAAGGAAAAACCGGGTGGCACGGGGGGGCCCCCCTTGGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCCCGGTCATTTCTGGT

Sequences - 3ʹ (reverse) EST

Accession: JZ839286
dbEST ID: 79656988
Trimmed Sequence: GTGGGCCACCGTGCACCCGGTTTCCTCGTGCTTGTGAAGGAGGGACATTCTGGAGAAAGTCCGAGAGCAGCTTTTGCACTGGTACTTTTTGACGTCGGAATGGGTCTGCAGGTGGGCTCGGAGATTGGAGCGGTCGGCGAAGGCACGGTTGCAGTGAGTACAGGAAAATGGCTTCTCTCCTGTGTGTGTTCTGATGTGTCCCTGTAATAACCACGGTCTGGAGAAGGCTTTGCCGCAGATTTTACAGACGCAGGGCAGCGTGTGGCTCCGGATGTGCATTTTTAAGGCACCCAAGCTGACGTACTCCTTCTCGCAGTATTTGCAACTGAACGACTTCCTCGTCTGGGAGTCACAGTGCAACTGTTTGTGCTTGGAAAGTCCGGCAAAGGTGGAGTAAGACTTGCTGCACAGATTGCATTGAAATTTCTCCGCTTCCGTGGCGGATGAAGCGGGGCTGGGAGGGTCCGAAGTCTTGCCCCCTTCATCTTCGCTGGAGAAGGACGTGAGGTCTAAGGGCTTGGAGGAATCGTCGCTGCTGGAAGGGCTGATGGGAAACTTTGTGTAATCGGACTCAAAGGTGAAAAATGTGGTGAGTAAACCAGTGTCCCCAACAAAAGGTGTGTAGTAAGCCCCTGTGCTTAAATCTCTTGCTGGGGGATCACAGG
Full Trace Sequence: GCAGGGAATCTGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTGGGCCACCGTGCACCCGGTTTCCTCGTGCTTGTGAAGGAGGGACATTCTGGAGAAAGTCCGAGAGCAGCTTTTGCACTGGTACTTTTTGACGTCGGAATGGGTCTGCAGGTGGGCTCGGAGATTGGAGCGGTCGGCGAAGGCACGGTTGCAGTGAGTACAGGAAAATGGCTTCTCTCCTGTGTGTGTTCTGATGTGTCCCTGTAATAACCACGGTCTGGAGAAGGCTTTGCCGCAGATTTTACAGACGCAGGGCAGCGTGTGGCTCCGGATGTGCATTTTTAAGGCACCCAAGCTGACGTACTCCTTCTCGCAGTATTTGCAACTGAACGACTTCCTCGTCTGGGAGTCACAGTGCAACTGTTTGTGCTTGGAAAGTCCGGCAAAGGTGGAGTAAGACTTGCTGCACAGATTGCATTGAAATTTCTCCGCTTCCGTGGCGGATGAAGCGGGGCTGGGAGGGTCCGAAGTCTTGCCCCCTTCATCTTCGCTGGAGAAGGACGTGAGGTCTAAGGGCTTGGAGGAATCGTCGCTGCTGGAAGGGCTGATGGGAAACTTTGTGTAATCGGACTCAAAGGTGAAAAATGTGGTGAGTAAACCAGTGTCCCCAACAAAAGGTGTGTAGTAAGCCCCTGTGCTTAAATCTCTTGCTGGGGGATCACAGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTGGGCCACCGTGCACC