ORFeome > snai2 ORF1 – XORFeome v1.0

snai2 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: snai2
Gene ID: 6255814
Gene Page ID: 487370
ORF Xenbase ID: 17297751

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054144
Original XGC clone length: 801

Human orthology & disease relationships

NCBI Entrez ID: 6591
Ensembl gene IDs: ENSG00000019549
Directly associated (OMIM) disease MIM numbers: 172800,608890
Indirectly associated (Lage, et al.) disease MIM numbers: 608890

Library Location

Plate ID: GDExl11001
Well Location: C05

Sequences - 5ʹ (forward) EST

Accession: JZ839136
dbEST ID: 79656838
Trimmed Sequence: ATGCCACGATCTTTTCTGGTCAAGAAACACTTCAACTCGGCCAAAAAGCCCAATTATGGGGAGTTGGACAACCATACAGTGATCATCTCCCCATTCCTATATGAGAGGTATCCTGTGTCTGTGCTTCCCCAGCCTGACATCTACAGCTCAGTGGCCTACAGCCCAATCACTGTGTGGACAGGACTGCTTCACCCACCGCTGCCCAGTGATCTCTCCCCTCTCTCAGGATACCCTTCATCTTTAGGACGGGTCAGCCCCCCTCCACAATCTGACACATCGTCTAAAGACCATAGTGGCTCGGAGAGCCCCATCAGCGACGAGGAGGAGAGACTCCAAACCAAACTTTCCGACTCGCATGCGATAGAGGCTGAGAAATTCCAGTGCAGCTTATGCAGCAAGACCTACTCTACTTTCTCTGGGTTGGCTAAGCACAAGCAGCTGCATTGCGACGCCCAGTCTCGGAAATCATTTAGCTGCAAGTACTGTGAAAAGGAGTATGTGAGCTTGGGCGCGCTAAAGATGCACATCAGGACACACACGTTACCCTGCGTATGTAAAATCTGTGGCAAAGCCTTTTCTAGACCGTGGCTACTACAAGGGCACATCCGCACTCACACTGGAGAAAAGCCCTTCTCGTGTCCACACTGCAACAAAAGCAATCGCAGACCGAATCCAACTTAGAAACCCACCCTGCCAACCCCTTTCTAATTTTAAAGAAATAATCATTGGCAAAAACCGGTTCCAAAAACTTTTCCCCTAAAAAGGGCCCCTCCCTTTCCAAAGACCAGGAAGGAAATC
Full Trace Sequence: CTCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCACGATCTTTTCTGGTCAAGAAACACTTCAACTCGGCCAAAAAGCCCAATTATGGGGAGTTGGACAACCATACAGTGATCATCTCCCCATTCCTATATGAGAGGTATCCTGTGTCTGTGCTTCCCCAGCCTGACATCTACAGCTCAGTGGCCTACAGCCCAATCACTGTGTGGACAGGACTGCTTCACCCACCGCTGCCCAGTGATCTCTCCCCTCTCTCAGGATACCCTTCATCTTTAGGACGGGTCAGCCCCCCTCCACAATCTGACACATCGTCTAAAGACCATAGTGGCTCGGAGAGCCCCATCAGCGACGAGGAGGAGAGACTCCAAACCAAACTTTCCGACTCGCATGCGATAGAGGCTGAGAAATTCCAGTGCAGCTTATGCAGCAAGACCTACTCTACTTTCTCTGGGTTGGCTAAGCACAAGCAGCTGCATTGCGACGCCCAGTCTCGGAAATCATTTAGCTGCAAGTACTGTGAAAAGGAGTATGTGAGCTTGGGCGCGCTAAAGATGCACATCAGGACACACACGTTACCCTGCGTATGTAAAATCTGTGGCAAAGCCTTTTCTAGACCGTGGCTACTACAAGGGCACATCCGCACTCACACTGGAGAAAAGCCCTTCTCGTGTCCACACTGCAACAAAAGCAATCGCAGACCGAATCCAACTTAGAAACCCACCCTGCCAACCCCTTTCTAATTTTAAAGAAATAATCATTGGCAAAAACCGGTTCCAAAAACTTTTCCCCTAAAAAGGGCCCCTCCCTTTCCAAAGACCAGGAAGGAAATC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCACGATCTTTTCTGGTCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ839135
dbEST ID: 79656837
Trimmed Sequence: ATGTGCTACACAGCAACCAGATTCCTCATGCTTGTGAAGGAGTGACATTCTAGAGAAAGTTTTGGAACAGTTCTTGCATTGATATTTCTTCACATCAGAATGGGTCTGCAGGTGGGCTCTTAAGTTGGATCTGTCTGCGAATGCTCTGTTGCAGTGTGGACACGAGAAGGGCTTTTCTCCAGTGTGAGTGCGGATGTGCCCTTGTAGTAGCCACGGTCTAGAAAAGGCTTTGCCACAGATTTTACATACGCAGGGTAACGTGTGTGTCCTGATGTGCATCTTTAGCGCGCCCAAGCTCACATACTCCTTTTCACAGTACTTGCAGCTAAATGATTTCCGAGACTGGGCGTCGCAATGCAGCTGCTTGTGCTTAGCCAACCCAGAGAAAGTAGAGTAGGTCTTGCTGCATAAGCTGCACTGGAATTTCTCAGCCTCTATCGCATGCGAGTCGGAAAGTTTGGTTTGGAGTCTCTCCTCCTCGTCGCTGATGGGGCTCTCCGAGCCACTATGGTCTTTAGACGATGTGTCAGATTGTGGAGGGGGGCTGACCCGTCCTAAAGATGAAGGGTATCCTGAGAGAGGGGAGAGATCACTGGGCAGCGGTGGGGTGAAGCAGTCCTGTCCACACAGTGATTGGGCCTGGAGGCACTGAACCTGAAAAATGTCAGGCGGGGGGAAACAACAGACACGGGATAACTTCTCCAAAAAAGAAATGGGAGAAAAAGAATAACCTGTAATGGTTTGTTCCAAACCCCCCCCA
Full Trace Sequence: GACGGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATGTGCTACACAGCAACCAGATTCCTCATGCTTGTGAAGGAGTGACATTCTAGAGAAAGTTTTGGAACAGTTCTTGCATTGATATTTCTTCACATCAGAATGGGTCTGCAGGTGGGCTCTTAAGTTGGATCTGTCTGCGAATGCTCTGTTGCAGTGTGGACACGAGAAGGGCTTTTCTCCAGTGTGAGTGCGGATGTGCCCTTGTAGTAGCCACGGTCTAGAAAAGGCTTTGCCACAGATTTTACATACGCAGGGTAACGTGTGTGTCCTGATGTGCATCTTTAGCGCGCCCAAGCTCACATACTCCTTTTCACAGTACTTGCAGCTAAATGATTTCCGAGACTGGGCGTCGCAATGCAGCTGCTTGTGCTTAGCCAACCCAGAGAAAGTAGAGTAGGTCTTGCTGCATAAGCTGCACTGGAATTTCTCAGCCTCTATCGCATGCGAGTCGGAAAGTTTGGTTTGGAGTCTCTCCTCCTCGTCGCTGATGGGGCTCTCCGAGCCACTATGGTCTTTAGACGATGTGTCAGATTGTGGAGGGGGGCTGACCCGTCCTAAAGATGAAGGGTATCCTGAGAGAGGGGAGAGATCACTGGGCAGCGGTGGGGTGAAGCAGTCCTGTCCACACAGTGATTGGGCCTGGAGGCACTGAACCTGAAAAATGTCAGGCGGGGGGAAACAACAGACACGGGATAACTTCTCCAAAAAAGAAATGGGAGAAAAAGAATAACCTGTAATGGTTTGTTCCAAACCCCCCCCA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATGTGCTACACAGCAACCAGA