ORFeome > snap25 ORF1 – XORFeome v1.0

snap25 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: snap25
Gene ID: 948776
Gene Page ID: 948768
ORF Xenbase ID: 17297763

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC055981
Original XGC clone length: 621

Human orthology & disease relationships

NCBI Entrez ID: 6616
Ensembl gene IDs: ENSG00000132639
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 177200,219700,264350

Library Location

Plate ID: GDExl11019
Well Location: A06

Sequences - 5ʹ (forward) EST

Accession: JZ824561
dbEST ID: 79642263
Trimmed Sequence: ATGGCAGACGACGCTGATATGCGCAATGAGCTGGAGGAGATGCAAAGGCGTGCAGATCAGCTGGCTGATGAGTCACTGGAGAGCACCCGCCGTATGCTGCAGTATGTTGAAGGGAGTAAAGATGCTGGTATCAGGACTTTGGTTATGTTGGATGAGCAAGGAGAACAACTGGAACGCATCGAGGAGGGAATGGAACAAATCAATAAGGACATGAAAGAAGCAGAAAAGAATTTGACGGACCTAGGAAAATTCTGTGGTCTATGTGTCTGTCCATGTAACAAGCTTAAATCCAGTGATGCTTACAAAAAGGCTTGGGGCAATAACCAAGATGGGGTTGTAGCAAGCCAACCTGCTCGTGTTGTGGATGAGCGTGAGCAGATGGCCATAAGTGGAGGCTTTGTCCGTAGAGTAACAAATGATGCCAGAGAAACAGAAATGGATGAAAACCTCGAGCAAGTCGGTGGCATTATTGGAAATCTTCGTCACATGGCCCTTGATATGGGCAATGAGATTGATACACAAAATCGCCAGATTGACAGGATCATGGAGAAGGCTGATTCCAACAAGGCCAGGATTGATGAGGCCAACAAACATGCCACAAAGATGCTGGGGCAGTGGTTT
Full Trace Sequence: AAATATTGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCAGACGACGCTGATATGCGCAATGAGCTGGAGGAGATGCAAAGGCGTGCAGATCAGCTGGCTGATGAGTCACTGGAGAGCACCCGCCGTATGCTGCAGTATGTTGAAGGGAGTAAAGATGCTGGTATCAGGACTTTGGTTATGTTGGATGAGCAAGGAGAACAACTGGAACGCATCGAGGAGGGAATGGAACAAATCAATAAGGACATGAAAGAAGCAGAAAAGAATTTGACGGACCTAGGAAAATTCTGTGGTCTATGTGTCTGTCCATGTAACAAGCTTAAATCCAGTGATGCTTACAAAAAGGCTTGGGGCAATAACCAAGATGGGGTTGTAGCAAGCCAACCTGCTCGTGTTGTGGATGAGCGTGAGCAGATGGCCATAAGTGGAGGCTTTGTCCGTAGAGTAACAAATGATGCCAGAGAAACAGAAATGGATGAAAACCTCGAGCAAGTCGGTGGCATTATTGGAAATCTTCGTCACATGGCCCTTGATATGGGCAATGAGATTGATACACAAAATCGCCAGATTGACAGGATCATGGAGAAGGCTGATTCCAACAAGGCCAGGATTGATGAGGCCAACAAACATGCCACAAAGATGCTGGGGCAGTGGTTTGCCAACTTTCTTGTACAAAGTTGGCATTNATAGAAAGCATTTGCTTATCATTTGTTTGCACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGCATCCAGCTGATATCCCCATATGTGAGTCGTATACAGGGGGTCATAGCTGTTCCTGCACTTGCGGAACCCACCACACCTTACATAAAAAAAAAAACAAAAAAAAAAAAAAAAAAAANNNC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAGACGACGCTGA

Sequences - 3ʹ (reverse) EST

Accession: JZ829912
dbEST ID: 79647614
Trimmed Sequence: ACCACTGCCCAGCATCTTTGTGGCATGTTTGTTGGCCTCATCAATCCTGGCCTTGTTGGAATCAGCCTTCTCCATGATCCTGTCAATCTGGCGATTTTGTGTATCAATCTCATTGCCCATATCAAGGGCCATGTGACGAAGATTTCCAATAATGCCACCGACTTGCTCGAGGTTTTCATCCATTTCTGTTTCTCTGGCATCATTTGTTACTCTACGGACAAAGCCTCCACTTATGGCCATCTGCTCACGCTCATCCACAACACGAGCAGGTTGGCTTGCTACAACCCCATCTTGGTTATTGCCCCAAGCCTTTTTGTAAGCATCACTGGATTTAAGCTTGTTACATGGACAGACACATAGACCACAGAATTTTCCTAGGTCCGTCAAATTCTTTTCTGCTTCTTTCATGTCCTTATTGATTTGTTCCATTCCCTCCTCGATGCGTTCCAGTTGTTCTCCTTGCTCATCCAACATAACCAAAGTCCTGATACCAGCATCTTTACTCCCTTCAACATACTGCAGCATACAGCGGGTGCTCTCCAGTGACTCATCAGCCAGCTGATCTGCACGCCTTTGCATCTCCTCCAGCTCATTGCGCAAATCAACGTCCTCTGGCCTGG
Full Trace Sequence: TGCCAGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAACCACTGCCCAGCATCTTTGTGGCATGTTTGTTGGCCTCATCAATCCTGGCCTTGTTGGAATCAGCCTTCTCCATGATCCTGTCAATCTGGCGATTTTGTGTATCAATCTCATTGCCCATATCAAGGGCCATGTGACGAAGATTTCCAATAATGCCACCGACTTGCTCGAGGTTTTCATCCATTTCTGTTTCTCTGGCATCATTTGTTACTCTACGGACAAAGCCTCCACTTATGGCCATCTGCTCACGCTCATCCACAACACGAGCAGGTTGGCTTGCTACAACCCCATCTTGGTTATTGCCCCAAGCCTTTTTGTAAGCATCACTGGATTTAAGCTTGTTACATGGACAGACACATAGACCACAGAATTTTCCTAGGTCCGTCAAATTCTTTTCTGCTTCTTTCATGTCCTTATTGATTTGTTCCATTCCCTCCTCGATGCGTTCCAGTTGTTCTCCTTGCTCATCCAACATAACCAAAGTCCTGATACCAGCATCTTTACTCCCTTCAACATACTGCAGCATACAGCGGGTGCTCTCCAGTGACTCATCAGCCAGCTGATCTGCACGCCTTTGCATCTCCTCCAGCTCATTGCGCAAATCAACGTCCTCTGGCCTGGTGGCAACTTTTTTTGTACAAAGTTGGGCATTATCAAAAAAGCATGGCTTCACAAATTGGTTGCAACCGAAAAGGGTCACCTATTAAGTTCAAAAAATAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACCACTGCCCAGCATCTT