ORFeome > snap47 ORF1 – XORFeome v1.0

snap47 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: snap47
Gene ID: 993043
Gene Page ID: 993038
ORF Xenbase ID: 17297775

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC130077
Original XGC clone length: 1092

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11090
Well Location: F02

Sequences - 5ʹ (forward) EST

Accession: JZ838501
dbEST ID: 79656203
Trimmed Sequence: ATGAGCTCGGACGTGTGTGTCCAGAACTGGTCATGTTCCTATTACCTGACAAGCGAGAAACGTTGGATCCCCGGCAGACTTTCCTTAACCCCGTCACGCCTGAAGTTTAAAGCTGATGGTGCACATGAGTTTCTCGTCAGCTTCCACCTCTCCAGCATTAATGAAATCAAAAAAGAGTCTTCCAGTTATATCTTTAGCTCCATCACCGTCCTGGAGAAGGACCAGGCCAAGCACTGGTTCAGCTCCCTCCAGCCCAATCGGAATGTGGCGTTTAACGTTATTCAGCATTTCTGGAGGGAACAGTTACTGACACCCCAAGGATCTCATACAGCCTCCTCCAAAACATCACAGGGAGGTGAATTTGTTAACAGGGTCACGGCATCCCAGAGTCACATGGAGGAAAGCACCAATGCGCTTCTTCACCAGGGGGAGCAGTTTGACAACATCCGTAAAGGTCTAGACAAGATTGAAGCAGACATGGCGACCACTGACAGGCTGCTCTCTGTCCTTGAGTCTCCATCATGGTGGCTATTCAGCAGAAAACCCTGGCAGAGCTGGAAGCAGGCTGAGCCTAAAGAATCACCTGGAGACGTGACTCCCCCCAATCATGGGAAGGAAGGGATTCTAATGAGCGTTCCCATTATATTCCTCCGCAAGCCAGACATTAACCTTAAACCAGGGAAAACTCACGTTCTGACGTCCCCCCTGGAGAATTCCCAATGGAACTCCCAACCTTCTTTCCTCCCTTCCCAAGGGGAAAATTTTGGAAGAAAATCAAAGGTGTGCCCCTGGGAAATTTAACTTCCCGCACTTCCCAAA
Full Trace Sequence: CCGGGGCCCATATAATGGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGCTCGGACGTGTGTGTCCAGAACTGGTCATGTTCCTATTACCTGACAAGCGAGAAACGTTGGATCCCCGGCAGACTTTCCTTAACCCCGTCACGCCTGAAGTTTAAAGCTGATGGTGCACATGAGTTTCTCGTCAGCTTCCACCTCTCCAGCATTAATGAAATCAAAAAAGAGTCTTCCAGTTATATCTTTAGCTCCATCACCGTCCTGGAGAAGGACCAGGCCAAGCACTGGTTCAGCTCCCTCCAGCCCAATCGGAATGTGGCGTTTAACGTTATTCAGCATTTCTGGAGGGAACAGTTACTGACACCCCAAGGATCTCATACAGCCTCCTCCAAAACATCACAGGGAGGTGAATTTGTTAACAGGGTCACGGCATCCCAGAGTCACATGGAGGAAAGCACCAATGCGCTTCTTCACCAGGGGGAGCAGTTTGACAACATCCGTAAAGGTCTAGACAAGATTGAAGCAGACATGGCGACCACTGACAGGCTGCTCTCTGTCCTTGAGTCTCCATCATGGTGGCTATTCAGCAGAAAACCCTGGCAGAGCTGGAAGCAGGCTGAGCCTAAAGAATCACCTGGAGACGTGACTCCCCCCAATCATGGGAAGGAAGGGATTCTAATGAGCGTTCCCATTATATTCCTCCGCAAGCCAGACATTAACCTTAAACCAGGGAAAACTCACGTTCTGACGTCCCCCCTGGAGAATTCCCAATGGAACTCCCAACCTTCTTTCCTCCCTTCCCAAGGGGAAAATTTTGGAAGAAAATCAAAGGTGTGCCCCTGGGAAATTTAACTTCCCGCACTTCCCAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGCTCGGACGTGTG

Sequences - 3ʹ (reverse) EST

Accession: JZ838500
dbEST ID: 79656202
Trimmed Sequence: ATTATTCCGTTTTTTGTTCAGCAACTCTCGGGTTGCTAGGGTTACATTTACCCTAGCAACCAGGCAGTGGTTTGAAGAAGAGACTGAAATATGAACAGGGAAAGGTGTGCCTGTTTCTGGACTAGACTGATCCCTCGGAGAGGATCTTCTGGACCCACTGAACATTAGGGCCTCCTCTAGGAACTCAATCTTCTTGCTGTACTGCATTTCTAACAGTGGGATGACATCTGGCAGTTTGGCAGACAAGATTTTATACGTGATGTCGGGTTTCCCAATAAACCTTTGTCGAATGCTGATGTCATATCCAGTGCACACTGTGATGTCATCCACATCTTCCCTTTGGTAGCGATGAAGCAACTGTGAGTTGCAGTCGGAAATCTCCGAGGCGGACGTCAGAACCGTGAGTTTCCCTGGTTTAAGGTTAATGTCTGGCTTGCGGGAGAATATTATGGGAACGCTCATTATAATCCCTTCCTTCCCATGATTTGGGGGAGTCACGTCTCCAGGTGATTCCTTAGGCTCAGCCTGCTTCCGCTCTGCCAGGGTTTTCGGCTGAATAGACAACAAGAAGGAAACTCAAGGAAAAAAAGCACCCTGGCAGTTTTGCGCAGGTCCGCTTCAACCTTGTCAAGACCTTTACGGAATTGTTCAACTGCTCCCCCAGGGAAAGAAGCGCAGGGAAGCTTTCCTCCTTGTTGCTCCTGGGATGCGGGGGCCCGGGTGAACAAAGTTCCCCTCCCACCTGAAATGTTTTTTAAAAAAAGAATG
Full Trace Sequence: AAAAGGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATTATTCCGTTTTTTGTTCAGCAACTCTCGGGTTGCTAGGGTTACATTTACCCTAGCAACCAGGCAGTGGTTTGAAGAAGAGACTGAAATATGAACAGGGAAAGGTGTGCCTGTTTCTGGACTAGACTGATCCCTCGGAGAGGATCTTCTGGACCCACTGAACATTAGGGCCTCCTCTAGGAACTCAATCTTCTTGCTGTACTGCATTTCTAACAGTGGGATGACATCTGGCAGTTTGGCAGACAAGATTTTATACGTGATGTCGGGTTTCCCAATAAACCTTTGTCGAATGCTGATGTCATATCCAGTGCACACTGTGATGTCATCCACATCTTCCCTTTGGTAGCGATGAAGCAACTGTGAGTTGCAGTCGGAAATCTCCGAGGCGGACGTCAGAACCGTGAGTTTCCCTGGTTTAAGGTTAATGTCTGGCTTGCGGGAGAATATTATGGGAACGCTCATTATAATCCCTTCCTTCCCATGATTTGGGGGAGTCACGTCTCCAGGTGATTCCTTAGGCTCAGCCTGCTTCCGCTCTGCCAGGGTTTTCGGCTGAATAGACAACAAGAAGGAAACTCAAGGAAAAAAAGCACCCTGGCAGTTTTGCGCAGGTCCGCTTCAACCTTGTCAAGACCTTTACGGAATTGTTCAACTGCTCCCCCAGGGAAAGAAGCGCAGGGAAGCTTTCCTCCTTGTTGCTCCTGGGATGCGGGGGCCCGGGTGAACAAAGTTCCCCTCCCACCTGAAATGTTTTTTAAAAAAAGAATG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATTATTCCGTTTTTTGTTCAG