ORFeome > snca ORF1 – XORFeome v1.0

snca ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: snca
Gene ID: 1014194
Gene Page ID: 1014190
ORF Xenbase ID: 17297805

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054200
Original XGC clone length: 426

Human orthology & disease relationships

NCBI Entrez ID: 6622
Ensembl gene IDs: ENSG00000145335
Directly associated (OMIM) disease MIM numbers: 127750,168601,605543
Indirectly associated (Lage, et al.) disease MIM numbers: 127750,168600,168601,266150,300257,605407,605543,606664,606952,608643

Library Location

Plate ID: GDExl11002
Well Location: F01

Sequences - 5ʹ (forward) EST

Accession: JZ839381
dbEST ID: 79657083
Trimmed Sequence: ATGGATGTATTCATGAAAGGGCTTTCCAAAGCTAAAGAGGGTGTTGTGGCAGCTGCAGAAAAAACCAAACAGGGAGTGGCAGAAGCAGCAGGAAAGACAAAAGAGGGTGTTCTCTATGTGGGTTCAAAAACAAAGGAAGGTGTTGTACATGGAGTAACAACAGTTGCTGAGAAGACCAAAGAGCAGGTGTCTAATGTTGGTGGAGCAGTAGTTACAGGGGTAACTGCAGTTGCACACAAGACAGTAGAAGGAGCCGGTAATTTTGCTGCAGCAACAGGCCTGGTAAAGAAGGATCAAAAGAATGAAAGCGGCTTCGGCCCAGAAGGGACAATGGAAAATTCAGAAAATATGCCGGTAAATCCAAATAATGAGACATATGAAATGCCGCCTGAGGAGGAATATCAAGATTATGATCCTGAAGCATT
Full Trace Sequence: CTCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGATGTATTCATGAAAGGGCTTTCCAAAGCTAAAGAGGGTGTTGTGGCAGCTGCAGAAAAAACCAAACAGGGAGTGGCAGAAGCAGCAGGAAAGACAAAAGAGGGTGTTCTCTATGTGGGTTCAAAAACAAAGGAAGGTGTTGTACATGGAGTAACAACAGTTGCTGAGAAGACCAAAGAGCAGGTGTCTAATGTTGGTGGAGCAGTAGTTACAGGGGTAACTGCAGTTGCACACAAGACAGTAGAAGGAGCCGGTAATTTTGCTGCAGCAACAGGCCTGGTAAAGAAGGATCAAAAGAATGAAAGCGGCTTCGGCCCAGAAGGGACAATGGAAAATTCAGAAAATATGCCGGTAAATCCAAATAATGAGACATATGAAATGCCGCCTGAGGAGGAATATCAAGATTATGATCCTGAAGCATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGAATTACATGGTCATAGCTGTTTCCTGAAAAAAGAAAAAAAAGAAACAAAATCTTAAAACGTTACAGAACAACCCCGGAGGAATTGGCTCTCTTTCCGCGTTAACCAAGGGTGGGGGGGGAGGATACAAAAAAAAAAGAAAAAAAAAAAAAACCAAAGAGAAAAAAAACCCTCCCGTGGAAAAAAATAAAAGAAGAAAGAACAAAACCCCCCCACAGGGGGGGCCGCAACAAAC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGATGTATTCATGAAAGGGCT

Sequences - 3ʹ (reverse) EST

Accession: JZ839380
dbEST ID: 79657082
Trimmed Sequence: TGCTTCAGGATCATAATCTTGATATTCCTCCTCAGGCGGCATTTCATATGTCTCATTATTTGGATTTACCGGCATATTTTCTGAATTTTCCATTGTCCCTTCTGGGCCGAAGCCGCTTTCATTCTTTTGATCCTTCTTTACCAGGCCTGTTGCTGCAGCAAAATTACCGGCTCCTTCTACTGTCTTGTGTGCAACTGCAGTTACCCCTGTAACTACTGCTCCACCAACATTAAACACCTGCTCTTTGGTCTTCTCAGCAACTGTTGTTACTCCATGTACAACACCTTCCTTTGTTTTTGAACCCACATAAAGAACACCCTCTTTTGTCTTTCCTGCTGCTTCTGCCACTCCCTGTTTGGTTTTTTCTGCAGCTGCCACAACACCCTCTTTACCTTTGGAAAGCCCTTTCATGAATACATCCTTGG
Full Trace Sequence: GACGGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGCTTCAGGATCATAATCTTGATATTCCTCCTCAGGCGGCATTTCATATGTCTCATTATTTGGATTTACCGGCATATTTTCTGAATTTTCCATTGTCCCTTCTGGGCCGAAGCCGCTTTCATTCTTTTGATCCTTCTTTACCAGGCCTGTTGCTGCAGCAAAATTACCGGCTCCTTCTACTGTCTTGTGTGCAACTGCAGTTACCCCTGTAACTACTGCTCCACCAACATTAAACACCTGCTCTTTGGTCTTCTCAGCAACTGTTGTTACTCCATGTACAACACCTTCCTTTGTTTTTGAACCCACATAAAGAACACCCTCTTTTGTCTTTCCTGCTGCTTCTGCCACTCCCTGTTTGGTTTTTTCTGCAGCTGCCACAACACCCTCTTTACCTTTGGAAAGCCCTTTCATGAATACATCCTTGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAATCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGAAAACCGAAGCATAATACTGGCCGTCGATTTACATCGCCGAGGACTGGGATATGCCCTCACCTCCCGGGACCCGAAAACCGGGGCTTCGATTTTCGGAAATTGTGAAGAAACGAAACACAAAAAAGAAAAAGTCTCGGACAAAGAATTAAATTATGTGAAGAACGCCGCGGGGGGGGGGGTCCAAACATTTACTGGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGCTTCAGGATCATAATCTTGATA