ORFeome > sncg ORF1 – XORFeome v1.0

sncg ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: sncg
Gene ID: 973679
Gene Page ID: 973673
ORF Xenbase ID: 17297817

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054269
Original XGC clone length: 390

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11001
Well Location: C02

Sequences - 5ʹ (forward) EST

Accession: JZ839108
dbEST ID: 79656810
Trimmed Sequence: ATGGATGTGTTTAAGAAAGGTTTTTCTATGGCTAAAGAAGGCGTGGTTGCTGCAGCAGAGAAAACCAAGCAGGGTGTGACAGAAGCTGCAGAAAAAACCAAGGAGGGGGTCATGTATGTAGGAGCGAAAACTAAAGAGGGTGTTGTACACAGTGTGAATACAGTTGCAGAGAAAACCAAAGAACAGGCCAATGTGGTTGGTGGAGCCGTGGTTTCTGGAGTAAATCAAGTATCTTCAAAGACTGTAGAAGGCACAGAGAATGTTGTAAGCTCTACTGGTTTAGTAAAAAAGGAAGATCTACATCCAGATCAGCCAGAAGAACCTGCTGCAGAAGAACCCGCAGTGGAGGCCACAGAAAGCATTGAGCAGGTCGGTGATGGAGAGAATTT
Full Trace Sequence: CTCGCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGATGTGTTTAAGAAAGGTTTTTCTATGGCTAAAGAAGGCGTGGTTGCTGCAGCAGAGAAAACCAAGCAGGGTGTGACAGAAGCTGCAGAAAAAACCAAGGAGGGGGTCATGTATGTAGGAGCGAAAACTAAAGAGGGTGTTGTACACAGTGTGAATACAGTTGCAGAGAAAACCAAAGAACAGGCCAATGTGGTTGGTGGAGCCGTGGTTTCTGGAGTAAATCAAGTATCTTCAAAGACTGTAGAAGGCACAGAGAATGTTGTAAGCTCTACTGGTTTAGTAAAAAAGGAAGATCTACATCCAGATCAGCCAGAAGAACCTGCTGCAGAAGAACCCGCAGTGGAGGCCACAGAAAGCATTGAGCAGGTCGGTGATGGAGAGAATTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCCGATACCCCCAACAGTGAGTCGTATTACAAGATCGTAGCTGGTTTCCTGGAAAAAAAAAGAAAAAAATCAGATTTCATCAGAACTAACAAAACCCCCGGGGAAAAAAAACCCCCAACGCCCTTCTCAAAACAGGTGGGGGTGGAAACAAACAAAGTGAATAAGGGTGAGACCCTCCCCCATAGGAGAAAACCCCCCGGCGGGCCCGGAGGGAAAGGGAGAGGGGCCGCCGGGCCGGCGCGCCGCGGCCCCGAAAAACTGGCGCGGAGGCAACGGGGGGAAGAGGGGGGGGAGGGGGTTTGTTTTCTGTTTCTGTTTCCACCTTTTGTTTTGTTGTGAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGATGTGTTTAAGAAAGG

Sequences - 3ʹ (reverse) EST

Accession: JZ839107
dbEST ID: 79656809
Trimmed Sequence: ATTCTCTCCATCACCGACCTGCTCAATGCTTTCTGTGGCCTCCACTGCGGGTTCTTCTGCAGCAGGTTCTTCTGGCTGATCTGGATGTAGATCTTCCTTTTTTACTAAACCAGTAGAGCTTACAACATTCTCTGTGCCTTCTACAGTCTTTGAAGATACTTGATTTACTCCAGAAACCACGGCTCCACCAACCACATTGGCCTGTTCTTTGGTTTTCTCTGCAACTGTATTCACACTGTGTACAACACCCTCTTTAGTTTTCGCTCCTACATACATGACCCCCTCCTTGGTTTTTTCTGCAGCTTCTGTCACACCCTGCTTGGTTTTCTCTGCTGCAGCAACCACGCCTTCTTTAGCCATAGAAAAACCTTTCTTAAACACATCCATGG
Full Trace Sequence: GACGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAAAAAGTTGGCAAATTCTCTCCATCACCGACCTGCTCAATGCTTTCTGTGGCCTCCACTGCGGGTTCTTCTGCAGCAGGTTCTTCTGGCTGATCTGGATGTAGATCTTCCTTTTTTACTAAACCAGTAGAGCTTACAACATTCTCTGTGCCTTCTACAGTCTTTGAAGATACTTGATTTACTCCAGAAACCACGGCTCCACCAACCACATTGGCCTGTTCTTTGGTTTTCTCTGCAACTGTATTCACACTGTGTACAACACCCTCTTTAGTTTTCGCTCCTACATACATGACCCCCTCCTTGGTTTTTTCTGCAGCTTCTGTCACACCCTGCTTGGTTTTCTCTGCTGCAGCAACCACGCCTTCTTTAGCCATAGAAAAACCTTTCTTAAACACATCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGCGCCCAACCTTAAAAAAGACCGTCGTTTTACATCATCTTGAACTGGGCAGTTTCATCACAGCACTGGCCGATGTTCTCTAATTCTCTAAAAAAAAAAAGAAAAAAATAAGTGGAAGAGGACTGGGGAGTGCCGAGGTATAGANAATGGCGGGGGGGNGGGAAGAGNGGTGGGGNGAAGGGTTGANNGGGGGAAGGAGGNNTTGNATANNANAAAAAGAAGTNTATAGCGGTGGNAGANGTAGAGGGGANATGGATTAAAGGATATGNGGAGANGGANCCG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATTCTCTCCATCACCGACCT