ORFeome > snrnp40 ORF1 – XORFeome v1.0

snrnp40 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: snrnp40
Gene ID: 957420
Gene Page ID: 957414
ORF Xenbase ID: 17297877

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054992
Original XGC clone length: 1014

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11003
Well Location: F05

Sequences - 5ʹ (forward) EST

Accession: JZ839533
dbEST ID: 79657235
Trimmed Sequence: ATGAACGAACAAAACAAGCGGAAGGGAATGGAACTGGTGCCGGTACTGGCGAAAAAACCACGGAATGAGTTGGTGGTTTCGGGTCCCCCAAGATCATCCAGTCTTCAGGCTCCAATCATGCTGCTCTCTGGTCATGAAGGAGAAGTATATTGCTGCAAATTTCATCCCAATGGTGTAACTTTGTCTTCTGCAGGATTTGACAGACTAATCCTGCTATGGAATGTATATGGCGACTGTGACAATTATGCAACTTTGAAAGGACATAGTGGAGCAGTGATGGAGCTTCATTATAATACAGATGGGAGCCTGCTATTCTCAGCATCAACTGATAGAACTGTTGCTATTTGGGACTGTGAAACAGGAGAAAGGGTGAAGCGGTTAAAGGGACATACATCATTTGTGAATTCATGTTACCCAGCAAGAAGGGGACCTCAGCTTATATGCACAGGGAGTGATGATGGCACAGTAAAGCTATGGGATTTCAGGAAAAAGGCTGCAGTACAGACCTTTCAAAATACATACCAAGTACTATCTGTCACATTCAATGACACCAGTGACCAGATCATCTCAGGAGGCATTGACAATGACATCAAGGTATGGGACTTGAGACAAAACAGCTTATGTATACAATGAGAGGTCATGGTGACTCTGTTACAGGGCCTTAGCCTCAGTTCTGAAGGCTCCTATCTTCTGTCTAATGCTATGAACATACAGTACTGTGTATGGGAATTCCGCCCTTTTTCTCCCAAAAAAAAATGTTTTGAAAAAATTTCAAGGAAATTGTGCCCAACTTTTGAAAAAAACCGGTTACCTTTCCCCTTTTGTCCTCCT
Full Trace Sequence: CGGGGCCCAAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAACGAACAAAACAAGCGGAAGGGAATGGAACTGGTGCCGGTACTGGCGAAAAAACCACGGAATGAGTTGGTGGTTTCGGGTCCCCCAAGATCATCCAGTCTTCAGGCTCCAATCATGCTGCTCTCTGGTCATGAAGGAGAAGTATATTGCTGCAAATTTCATCCCAATGGTGTAACTTTGTCTTCTGCAGGATTTGACAGACTAATCCTGCTATGGAATGTATATGGCGACTGTGACAATTATGCAACTTTGAAAGGACATAGTGGAGCAGTGATGGAGCTTCATTATAATACAGATGGGAGCCTGCTATTCTCAGCATCAACTGATAGAACTGTTGCTATTTGGGACTGTGAAACAGGAGAAAGGGTGAAGCGGTTAAAGGGACATACATCATTTGTGAATTCATGTTACCCAGCAAGAAGGGGACCTCAGCTTATATGCACAGGGAGTGATGATGGCACAGTAAAGCTATGGGATTTCAGGAAAAAGGCTGCAGTACAGACCTTTCAAAATACATACCAAGTACTATCTGTCACATTCAATGACACCAGTGACCAGATCATCTCAGGAGGCATTGACAATGACATCAAGGTATGGGACTTGAGACAAAACAGCTTATGTATACAATGAGAGGTCATGGTGACTCTGTTACAGGGCCTTAGCCTCAGTTCTGAAGGCTCCTATCTTCTGTCTAATGCTATGAACATACAGTACTGTGTATGGGAATTCCGCCCTTTTTCTCCCAAAAAAAAATGTTTTGAAAAAATTTCAAGGAAATTGTGCCCAACTTTTGAAAAAAACCGGTTACCTTTCCCCTTTTGTCCTCCT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAACGAACAAAACAAGCGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ839532
dbEST ID: 79657234
Trimmed Sequence: CTGGATCTCCCCCAAATACAATCTCTTGTCATTGGAGGCAGAGAGAATAATTGGCTCCTCAGGGTGAAAAGCCACCTCATTGACAGACCCAGCGTGACCAGGAAGCTTGTAAAGGACCCGGCGTGATGTAGTATCCCAAACATAAACAAATCTGTCTGCGGATCCTGCGGCTATTTTGCTTCCATCAGCAGACCAAGAGGAACGTAACAGGTTCTTTTCAAAGTTGTGCACATTTCCTTGGAATATCTTCACACATCTCTCTTTTGGAGCAAAAGGGCGGACATCCCATACACGTACTGTATTGTCCATAGCATTAGACAGAAGATAGGAGCCCTCAGAACTGAGGCTAAGCCCTGTAACAGAGTCACCATGACCTCTCATTGTATACATAAGCTTGTTTTGTCTCAAGTCCCATACCTTGATGTCATTGTCAATGCCTCCTGAGATGATCTGGTCACTGGTGTCATTGAATGTGACAGATAGTACTTGGTATGTATTTTGAAAGGTCTGTACTGCAGCCTTTTTCCTGAAATCCCATAGCTTTACTGTGCCATCATCACTCCCCGTGCATATAAGCTGAGGTCCCCTTCTTGCTGGGGTAGATGAAATTCACAATGAAGTATGTCCCTTTTAATCCCTTCCCCCCTTTCTCCGGTTTCAAAGTCCCAAATTGCAACAAGTTCTATCAGTTTAATGCTGAAAAATAGAAGGGCTCCCGTCTGGAATTAGAAAGGAAACCTTCATCCCTTGCCCCCCCCAATTGTCCCTTTTC
Full Trace Sequence: GAACGGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTGGATCTCCCCCAAATACAATCTCTTGTCATTGGAGGCAGAGAGAATAATTGGCTCCTCAGGGTGAAAAGCCACCTCATTGACAGACCCAGCGTGACCAGGAAGCTTGTAAAGGACCCGGCGTGATGTAGTATCCCAAACATAAACAAATCTGTCTGCGGATCCTGCGGCTATTTTGCTTCCATCAGCAGACCAAGAGGAACGTAACAGGTTCTTTTCAAAGTTGTGCACATTTCCTTGGAATATCTTCACACATCTCTCTTTTGGAGCAAAAGGGCGGACATCCCATACACGTACTGTATTGTCCATAGCATTAGACAGAAGATAGGAGCCCTCAGAACTGAGGCTAAGCCCTGTAACAGAGTCACCATGACCTCTCATTGTATACATAAGCTTGTTTTGTCTCAAGTCCCATACCTTGATGTCATTGTCAATGCCTCCTGAGATGATCTGGTCACTGGTGTCATTGAATGTGACAGATAGTACTTGGTATGTATTTTGAAAGGTCTGTACTGCAGCCTTTTTCCTGAAATCCCATAGCTTTACTGTGCCATCATCACTCCCCGTGCATATAAGCTGAGGTCCCCTTCTTGCTGGGGTAGATGAAATTCACAATGAAGTATGTCCCTTTTAATCCCTTCCCCCCTTTCTCCGGTTTCAAAGTCCCAAATTGCAACAAGTTCTATCAGTTTAATGCTGAAAAATAGAAGGGCTCCCGTCTGGAATTAGAAAGGAAACCTTCATCCCTTGCCCCCCCCAATTGTCCCTTTTC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTGGATCTCCCCCAAATACAA