ORFeome > snrpd1 ORF3 – XORFeome v1.0

snrpd1 ORF3 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: snrpd1
Gene ID: 6251886
Gene Page ID: 5789947
ORF Xenbase ID: 17297961

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC128953
Original XGC clone length: 360

Human orthology & disease relationships

NCBI Entrez ID: 6632
Ensembl gene IDs: ENSG00000167088
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 148700,154500,162210,164300,193520,214450,253300,253400,253550,256710,300590,303600,600059,600334,603689,604145,608807,608808,609065,609227

Library Location

Plate ID: GDExl11093
Well Location: B01

Sequences - 5ʹ (forward) EST

Accession: JZ838912
dbEST ID: 79656614
Trimmed Sequence: ATGAAGTTAGTTAGGTTTTTGATGAAATTAAGTCACGAAACGGTCACAGTGGAACTTAAAAATGGCACGCAAGTGCACGGCACAATCACAGGGGTAAATGTGAGCATGAACACACACCTGAAAGCTGTTAAAATGACCGTGAAAAACAAAAAACCTGTTCAACTGGAAACATTAAGCATTCAAGGAAATAATATACGTTACTTTATTCTTCCAAACAGTTTGCCTCTTGACACTTTACTTGTTGACGTGGAGCCAAAAGTAAAGTCAAAAAAAAGGGAGGCTGTTGCTGGCAAAGGAAAAGGCAAAGGCCGTGGTAAAGGCCGAGGGCGAGGAAAAGGGAAAGGAGGCCCAAGGAAATT
Full Trace Sequence: TCGGGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAAGTTAGTTAGGTTTTTGATGAAATTAAGTCACGAAACGGTCACAGTGGAACTTAAAAATGGCACGCAAGTGCACGGCACAATCACAGGGGTAAATGTGAGCATGAACACACACCTGAAAGCTGTTAAAATGACCGTGAAAAACAAAAAACCTGTTCAACTGGAAACATTAAGCATTCAAGGAAATAATATACGTTACTTTATTCTTCCAAACAGTTTGCCTCTTGACACTTTACTTGTTGACGTGGAGCCAAAAGTAAAGTCAAAAAAAAGGGAGGCTGTTGCTGGCAAAGGAAAAGGCAAAGGCCGTGGTAAAGGCCGAGGGCGAGGAAAAGGGAAAGGAGGCCCAAGGAAATTGCCAACTTTCTTGTACAAATTTGGCATTATAAAAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCACCCACCTAATACCCCCTATAGGGATTCTAATTACATGTAACAAACCGGTTCCCGGAAAAAAAAAAAAACGCATCCCGGTTCTCTCGTGGTCCCACGGGGCCGGGGCGGGTCGNNTTCGCCCTGCCGCCCGCCGCCAAAAAAAAGAGGGGGGGTTAAAACACAAGAAAAAAAAAAAAAACCAACAGCCCGGGGAGATATCTCTCCCGCTGTCGTATAAATTGTGAAAGGAATAAGAAGGGCCCCCCGCCNACGCCTACACAATACCAGCGCCACAAAGAAGGGGGGGGGAGGAGAATGGTGCGCGGTTATCCTATCTATGTTAAACTCTGTGGTGGAAGGTTAAAAAAGAGTTGAAAAGCCCCCCAAAAAAAAAGGAAGCACAAAAC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAGTTAGTTAGGTTTTTG

Sequences - 3ʹ (reverse) EST

Accession: JZ838911
dbEST ID: 79656613
Trimmed Sequence: TCTCCTTGGGCCTCCTCTCCCTCTTCCTCGCCCTCGGCCTCTACCACGGCCTCTGCCTCTTCCTCTGCCAGCAACAGCCTCCCTTTTCTTTGACTTTACTTTTGGCTCCACGTCAACAAGTAAAGTGTCAAAAGGCAAACTGTCTGGAAAAATAAAGTAACGTATATAATTTCCTCGAATGCTTAATGTCTCCAGTTGAACAGGTTCTCTGTTCTTCACGGTCATTTTAACAGCTTTCAGGTGTGTGTTCATGCTCACATCTACCCCTGTGATTGTGCCGTGCACTTGCGTGCCATTCTTAAGTTCCACTGTGACCGTTTCGTGACTTAATTTCATCAAAAACCTAACTAACTTCATGG
Full Trace Sequence: GGGAAACTGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATCTCCTTGGGCCTCCTCTCCCTCTTCCTCGCCCTCGGCCTCTACCACGGCCTCTGCCTCTTCCTCTGCCAGCAACAGCCTCCCTTTTCTTTGACTTTACTTTTGGCTCCACGTCAACAAGTAAAGTGTCAAAAGGCAAACTGTCTGGAAAAATAAAGTAACGTATATAATTTCCTCGAATGCTTAATGTCTCCAGTTGAACAGGTTCTCTGTTCTTCACGGTCATTTTAACAGCTTTCAGGTGTGTGTTCATGCTCACATCTACCCCTGTGATTGTGCCGTGCACTTGCGTGCCATTCTTAAGTTCCACTGTGACCGTTTCGTGACTTAATTTCATCAAAAACCTAACTAACTTCATGGTGCCAACTTTTTTGTACAAATTTGGCATTATAAAAAACCATTGCTCATCAATTTGTGGCAACAAACAGGTCACAATCATTCAAAATAAAATCTTTATTTGGGGCCGAACCAAAAAAGAAAAATTCTTTTTACACTCCTTTGACTGGGGGGGAAAAAAAAAANNNNNNGNCCAGNGAGGAGAAAAAAAAAAAGAAACAGGNNNNAAAAAAAGGAGGAAAGGGAAAGAAGNGACCNGNGGNNANNNNGCGGGGGGGGGNAGGGNNNNNNGGGGAAANNNGGGGGGNGGGNNNNNNNNNNNANNNNNNNNNNNNNNNNGNNAGGGGGNGGNNNNNNGANGGGGNNNNNGGGGGGNANGGNGGGNNNNNNNNNAAGNNNANNANNNNNNANNNNNNNGNGNNNNANNGNGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATCTCCTTGGGCCTCCTCT