ORFeome > snrpg ORF1 – XORFeome v1.0

snrpg ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: snrpg
Gene ID: 5874589
Gene Page ID: 5874500
ORF Xenbase ID: 17297991

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123339
Original XGC clone length: 231

Human orthology & disease relationships

NCBI Entrez ID: 6637
Ensembl gene IDs: ENSG00000143977
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 148700,162210,164300,193520,214450,256710,300590,303600,609065,609227

Library Location

Plate ID: GDExl11084
Well Location: G01

Sequences - 5ʹ (forward) EST

Accession: JZ837332
dbEST ID: 79655034
Trimmed Sequence: ATGAGCAAAGCACACCCGCCCGAGTTGAAGAAGTTCATGGACAAGAAACTGTCTTTGAAGATAAATGGTGGCAGACAAGTCCAAGGGATTCTGCGTGGGTTCGACCCCTTCATGAACCTTGTACTAGATGAGTCCACAGAGATATCAGGAAGTGGTAACCAAAATAGCATTGGAATGGTGGTAATTCGAGGGAACAGCATTATAATGCTGGAAGCTTTGGAACGAGTTTT
Full Trace Sequence: TCGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGCAAAGCACACCCGCCCGAGTTGAAGAAGTTCATGGACAAGAAACTGTCTTTGAAGATAAATGGTGGCAGACAAGTCCAAGGGATTCTGCGTGGGTTCGACCCCTTCATGAACCTTGTACTAGATGAGTCCACAGAGATATCAGGAAGTGGTAACCAAAATAGCATTGGAATGGTGGTAATTCGAGGGAACAGCATTATAATGCTGGAAGCTTTGGAACGAGTTTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCAAAAACAACAAACAAAAAATAAAACAAGACTCCGGAACAGCAACGCAGACAAAAATAAAAAAAGGTCACTGCGACCCCCGGGGCCGGGGGAGGCACGTTGTTTGTCCGGGAGAACGCTCCCAACCCCGGGAAAAAGCCCGGACCGGCTTTTAGGTGTATGGAAATAGCGCTAGGAAGCCCCCCCCCAAGTCCCCCACCCTTGACGAAACTAAAGGGTGGGAGGGGGGGGGTGGGGGGTTTCTTGGCGGTTTTTTTTGGTTTTTATATTCTTGTAATTAATAGCCCCCCGGGTCCCCACCCCGCGCCACATGCCCCCCGTTGGTCTTTGTGTTTTTTTTTATGATTTTTTTTAATTTGTGGAGAAAACAAGAGAATCCCCCCCCCCCGGCACAAACAACAAAAAAAAAAAAAGGAGGGGGAGGGGGGTGTCCGGCGGGGGGGGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGCAAAGCACACCCGCC

Sequences - 3ʹ (reverse) EST

Accession: JZ837331
dbEST ID: 79655033
Trimmed Sequence: AACTCGTTCCAAAGCTTCCAGCATTATAATGCTGTTCCCTCGAATTACCACCATTCCAATGCTATTTTGGTTACCACTTCCTGATATCTCTGTGGACTCATCTAGTACAAGGTTCATGAAGGGGTCGAACCCACGCAGAATCCCTTGGACTTGTCTGCCACCATTTATCTTCAAAGACAGTTTCTTGTCCATGAACTTCTTCAACTCGGGCGGGTGTGCTTTGCTCATGG
Full Trace Sequence: CGGGAATAGGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAACTCGTTCCAAAGCTTCCAGCATTATAATGCTGTTCCCTCGAATTACCACCATTCCAATGCTATTTTGGTTACCACTTCCTGATATCTCTGTGGACTCATCTAGTACAAGGTTCATGAAGGGGTCGAACCCACGCAGAATCCCTTGGACTTGTCTGCCACCATTTATCTTCAAAGACAGTTTCTTGTCCATGAACTTCTTCAACTCGGGCGGGTGTGCTTTGCTCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGACCTTAATACTGGACAAAGAAATTAAACAAGCATACAGCAAGAGTACGGAACAGCAAGGCGACAGAAGAGCGAAAAGCTCACTGGTACAACGGGTGCTTGGTGTTATATGTTGGGTAACGGGGAAAGGCACGAAGACAAGGAAAATCCGCCCGGAAGGGACTTGAAGTGTATGGAGAGACCGCTTGGGAGGGGGGGCAACTGGGTCCGAAAGTTGAAAAAACTTAAACGGTGGTAGAGGGGCAATGGGGGGGTTAATAGGGGTGTTAAAGAATGTTTTTATTGGGGGACATTCTAATGCTCCGGGCGACCCGACCCAACACACCCGCTCCCCCCGTGGGGGCGATTGTTGGAGTTAAAGAGATGCACCTTCAAATATTACACAACACAAACCCAGCCCCCCCCTACACCAAGGCATAAAAACAATAATAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAACTCGTTCCAAAGCTTCCA