ORFeome > snrpn-prov ORF1 – XORFeome v1.0

snrpn-prov ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6254681
Gene Page ID:
ORF Xenbase ID: 17297997

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC041275
Original XGC clone length: 711

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11009
Well Location: G10

Sequences - 5ʹ (forward) EST

Accession: JZ823722
dbEST ID: 79641424
Trimmed Sequence: ATGACAGTGGGAAAAAGCAGCAAGATGCTGCAGCACATTGACTTCAGAATGCGCTGTATCCTGCAAGATGGCCGGATCTTTATTGGAACATTCAAGGCATTTGACAAACACATGAATCTGATCTTATGCGACTGTGATGAATTCAGAAAGATTAAGCCAAAGAATTCAAAACAGCCAGAACGTGAAGAAAAGAGGGTACTTGGTCTAGTGTTGCTTCGAGGGGAGAACTTGGTTTCAATGACTGTTGAAGGCCCACCTCCCAAAGATACTGGTATTGCTAGGGTTCCATTGGCAGGTGCTGCCGGAGGACCTGGAGTAGGCAGGGCAGCTGGTAGAGGTGTACCCGCTGGAGCACCTATGCCACAGGCTCCTGCTGGACTGGCAGGACCAGTACGTGGCGTTGGAGGACCTTCACAGCAGGTTATGACACCTCAGGGTCGTGGTAATGTGGTGGCAGCTGCTGCAGCCGCCACAGCAAGCATTGCTGGGGCCCCAACACAGTATGCAGGTCGAGGAGGACCACCTCCACCAATGGGCAGAGGAGCACCCCCACCAGGCATGATGGGACCACCCCCTGGCATGAGGCCACCAATGGGTCCACCAATGGGAATGCCTCCAGGCAGAGGAGGACCTATGGGAATGCTACCTCCAGGGATGAGACCACCTCCACCTGGACCTCCACCACCTGGCATGCGACCCACTCGGCCATT
Full Trace Sequence: CAATAATGAATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACAGTGGGAAAAAGCAGCAAGATGCTGCAGCACATTGACTTCAGAATGCGCTGTATCCTGCAAGATGGCCGGATCTTTATTGGAACATTCAAGGCATTTGACAAACACATGAATCTGATCTTATGCGACTGTGATGAATTCAGAAAGATTAAGCCAAAGAATTCAAAACAGCCAGAACGTGAAGAAAAGAGGGTACTTGGTCTAGTGTTGCTTCGAGGGGAGAACTTGGTTTCAATGACTGTTGAAGGCCCACCTCCCAAAGATACTGGTATTGCTAGGGTTCCATTGGCAGGTGCTGCCGGAGGACCTGGAGTAGGCAGGGCAGCTGGTAGAGGTGTACCCGCTGGAGCACCTATGCCACAGGCTCCTGCTGGACTGGCAGGACCAGTACGTGGCGTTGGAGGACCTTCACAGCAGGTTATGACACCTCAGGGTCGTGGTAATGTGGTGGCAGCTGCTGCAGCCGCCACAGCAAGCATTGCTGGGGCCCCAACACAGTATGCAGGTCGAGGAGGACCACCTCCACCAATGGGCAGAGGAGCACCCCCACCAGGCATGATGGGACCACCCCCTGGCATGAGGCCACCAATGGGTCCACCAATGGGAATGCCTCCAGGCAGAGGAGGACCTATGGGAATGCTACCTCCAGGGATGAGACCACCTCCACCTGGACCTCCACCACCTGGCATGCGACCCACTCGGCCATTGCCAACTTTTCTTGTACAAAGGTGGGCATTATAAGAAAGCATTGCCTTATCAATTTTGTTGCAACGAACAGGGTCACTAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACAGTGGGAAAAAGCAGCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ829031
dbEST ID: 79646733
Trimmed Sequence: TGGCCGAGTGGGTCGCATGCCAGGTGGTGGAGGTCCAGGTGGAGGTGGTCTCATCCCTGGAGGTAGCATTCCCATAGGTCCTCCTCTGCCTGGAGGCATTCCCATTGGTGGACCCATTGGTGGCCTCATGCCAGGGGGTGGTCCCATCATGCCTGGTGGGGGTGCTCCTCTGCCCATTGGTGGAGGTGGTCCTCCTCGACCTGCATACTGTGTTGGGGCCCCAGCAATGCTTGCTGTGGCGGCTGCAGCAGCTGCCACCACATTACCACGACCCTGAGGTGTCATAACCTGCTGTGAAGGTCCTCCAACGCCACGTACTGGTCCTGCCAGTCCAGCAGGAGCCTGTGGCATAGGTGCTCCAGCGGGTACACCTCTACCAGCTGCCCTGCCTACTCCAGGTCCTCCGGCAGCACCTGCCAATGGAACCCTAGCAATACCAGTATCTTTGGGAGGTGGGCCTTCAACAGTCATTGAAACCAAGTTCTCCCCTCGAAGCAACACTAGACCAAGTACCCTCTTTTCTTCACGTTCTGGCTGTTTTGAATTCTTTGGCTTAATCTTTCTGAATTCATCACAGTCGCATAAAATCAGATTCATGTGTTTGTCAAATGCCTTGAATGTTCCAAATAAGATCCCGGCAACTTGCAGGATACAGCGCCATTCTGAAGTCAATGTGCCTGAAGCCTTCTGGCTGCTTTTTTCCCCCCTGTCCTGGGTGCCCAACTTTTTTTGGTTACAAAGTTGTGGCATTTAATAAAAGAAGCACTTTGGC
Full Trace Sequence: ACGGCAAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGGCCGAGTGGGTCGCATGCCAGGTGGTGGAGGTCCAGGTGGAGGTGGTCTCATCCCTGGAGGTAGCATTCCCATAGGTCCTCCTCTGCCTGGAGGCATTCCCATTGGTGGACCCATTGGTGGCCTCATGCCAGGGGGTGGTCCCATCATGCCTGGTGGGGGTGCTCCTCTGCCCATTGGTGGAGGTGGTCCTCCTCGACCTGCATACTGTGTTGGGGCCCCAGCAATGCTTGCTGTGGCGGCTGCAGCAGCTGCCACCACATTACCACGACCCTGAGGTGTCATAACCTGCTGTGAAGGTCCTCCAACGCCACGTACTGGTCCTGCCAGTCCAGCAGGAGCCTGTGGCATAGGTGCTCCAGCGGGTACACCTCTACCAGCTGCCCTGCCTACTCCAGGTCCTCCGGCAGCACCTGCCAATGGAACCCTAGCAATACCAGTATCTTTGGGAGGTGGGCCTTCAACAGTCATTGAAACCAAGTTCTCCCCTCGAAGCAACACTAGACCAAGTACCCTCTTTTCTTCACGTTCTGGCTGTTTTGAATTCTTTGGCTTAATCTTTCTGAATTCATCACAGTCGCATAAAATCAGATTCATGTGTTTGTCAAATGCCTTGAATGTTCCAAATAAGATCCCGGCAACTTGCAGGATACAGCGCCATTCTGAAGTCAATGTGCCTGAAGCCTTCTGGCTGCTTTTTTCCCCCCTGTCCTGGGTGCCCAACTTTTTTTGGTTACAAAGTTGTGGCATTTAATAAAAGAAGCACTTTGGC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGGCCGAGTGGGTCGCAT