ORFeome > snw1 ORF1 – XORFeome v1.0

snw1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: snw1
Gene ID: 6254711
Gene Page ID: 1006927
ORF Xenbase ID: 17298021

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC108751
Original XGC clone length: 1608

Human orthology & disease relationships

NCBI Entrez ID: 22938
Ensembl gene IDs: ENSG00000100603
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 164300,174900,175050,260350,300590,600059,609192

Library Location

Plate ID: GDExl11078
Well Location: F04

Sequences - 5ʹ (forward) EST

Accession: JZ836419
dbEST ID: 79654121
Trimmed Sequence: ATGGCGCTAGCCAGTTTTTTGCCTGCTCCAACACAGTTATCACAGGATCAGCTAGAGGCAGAAGAAAAGCTGAGAGCACAGAAATCTCGTCAGACAGCTCTAGTGTCATCACGGCGTGAACCACCTCCCTATGGCCACAGGAAAGGATGGGTTCCCAGATCCCTCGAGGATTTTGGAGATGGCGGTGCTTTTCCAGAGATACATGTGGCACAATACCCACTGGACATGGGGCGAAAAAAGAAAATGTCCAATGCCTTGGCTGTGCAGGTGGATGCAGAAGGAAAAATAAAATATGATGCTATTGCTCGACAGGGACAATCCAAAGATAAGGTTCTTTTCAGCAAGTACACAGACCTGGTACCTAAAGAGGTGATGGATGAAGATGATCCTGAACTACAAAGACCTGATGAGGAAGCTATTAAAGAGCTCACAGAGAAGACAAGACAGGCTCTGGACAAATCCGTGTCCCAGAAGATTGCTGCAGCGATGCCTGTACGGGCTGCAGATAAACTGGCCCCTGCACAGTATATTAGGTACACACCCTCTCAACAGGGGGTGGCTTTTAACTCTGGTGCCAAACAGAGGGTGATTCGGATGGTGGAGATGCAAAAGGACCCCATGGAGCCACCTCGATTCAAATTAATAAGAAAAATCCACATGGACCTCCCTCTCCTCCAGCGACGGTAATGCATTCCCCCAGCCAAAAGGATGACGGGTAAGGGAACAGCAAGAAGGGGAGAATTCCCCCCCGGGGTATTTCCTAACTGGGAAGAAAAGGCCAAGGGGGTTAATAC
Full Trace Sequence: GGTCTAGGCTCGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGCTAGCCAGTTTTTTGCCTGCTCCAACACAGTTATCACAGGATCAGCTAGAGGCAGAAGAAAAGCTGAGAGCACAGAAATCTCGTCAGACAGCTCTAGTGTCATCACGGCGTGAACCACCTCCCTATGGCCACAGGAAAGGATGGGTTCCCAGATCCCTCGAGGATTTTGGAGATGGCGGTGCTTTTCCAGAGATACATGTGGCACAATACCCACTGGACATGGGGCGAAAAAAGAAAATGTCCAATGCCTTGGCTGTGCAGGTGGATGCAGAAGGAAAAATAAAATATGATGCTATTGCTCGACAGGGACAATCCAAAGATAAGGTTCTTTTCAGCAAGTACACAGACCTGGTACCTAAAGAGGTGATGGATGAAGATGATCCTGAACTACAAAGACCTGATGAGGAAGCTATTAAAGAGCTCACAGAGAAGACAAGACAGGCTCTGGACAAATCCGTGTCCCAGAAGATTGCTGCAGCGATGCCTGTACGGGCTGCAGATAAACTGGCCCCTGCACAGTATATTAGGTACACACCCTCTCAACAGGGGGTGGCTTTTAACTCTGGTGCCAAACAGAGGGTGATTCGGATGGTGGAGATGCAAAAGGACCCCATGGAGCCACCTCGATTCAAATTAATAAGAAAAATCCACATGGACCTCCCTCTCCTCCAGCGACGGTAATGCATTCCCCCAGCCAAAAGGATGACGGGTAAGGGAACAGCAAGAAGGGGAGAATTCCCCCCCGGGGTATTTCCTAACTGGGAAGAAAAGGCCAAGGGGGTTAATAC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGCTAGCCAGTTTT

Sequences - 3ʹ (reverse) EST

Accession: JZ836420
dbEST ID: 79654122
Trimmed Sequence: CTCCTTCCTGCGCTTCTTCATATCATGGTCATGATCTTTAGCCCGACCACTATCAGAGGGACGCTTAGATCCTCCATGCTGTTTAGCCTCCTCCAAAAACTTGTCCAAACCAAAAGGATCCTCTTCAAATTGCACAGGCCCCTCATGGCGCTGCCTGCGATCTGCACCAGAAAAGTCCTTGTCAGGAACAAACCTGTTGGTTTTCACTAATGTGTCCAGGTCATCACCATAAACATCGTTGTCCGTATTCTTACTGGGACGGTAGATGTTCTGCGCCAGTTTCTTGTTGCCTAACCATGGCTGGTCATACACGTTATATACCTCATCCTCTCCACCAGCAAAGCCACTATCCATACCTCTGCTTTGGTTGAAAAGTCGTTGGTCATACTGGATTTCACTGGATGTCCTCTGATTAGGAATTCCAAGCGCAATCTGTTCACTAATGTCTCTTTCTTCATTCCTTTGGAGTTTGGACCTCTTGTCTGGGGCTGCCCTAGATATGTTCCGTTCATGTTGCCGTTCCTTGCGTCTCTCATGTCGAATATCATCCCTCTCTTTGGCTTCTCCATCCTCTTTTTCTGTATGGGACTTGATCCCAGCTCTGCGTTCTCTTGNCATCTGTGCCAATTCCCTAAGTTTTTCCTCTTTTTTCTCCTTTCTCTTTTTGTGCCATCTTGGCGCTCCACCTGGGGCCCTCATCTCCACAGGCTTCACCGAGCCCTTTTCTGTCAACCCAAGGTACCAAAGGCCTTCCCCCAAACCTTA
Full Trace Sequence: CCGTGTAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTCCTTCCTGCGCTTCTTCATATCATGGTCATGATCTTTAGCCCGACCACTATCAGAGGGACGCTTAGATCCTCCATGCTGTTTAGCCTCCTCCAAAAACTTGTCCAAACCAAAAGGATCCTCTTCAAATTGCACAGGCCCCTCATGGCGCTGCCTGCGATCTGCACCAGAAAAGTCCTTGTCAGGAACAAACCTGTTGGTTTTCACTAATGTGTCCAGGTCATCACCATAAACATCGTTGTCCGTATTCTTACTGGGACGGTAGATGTTCTGCGCCAGTTTCTTGTTGCCTAACCATGGCTGGTCATACACGTTATATACCTCATCCTCTCCACCAGCAAAGCCACTATCCATACCTCTGCTTTGGTTGAAAAGTCGTTGGTCATACTGGATTTCACTGGATGTCCTCTGATTAGGAATTCCAAGCGCAATCTGTTCACTAATGTCTCTTTCTTCATTCCTTTGGAGTTTGGACCTCTTGTCTGGGGCTGCCCTAGATATGTTCCGTTCATGTTGCCGTTCCTTGCGTCTCTCATGTCGAATATCATCCCTCTCTTTGGCTTCTCCATCCTCTTTTTCTGTATGGGACTTGATCCCAGCTCTGCGTTCTCTTGNCATCTGTGCCAATTCCCTAAGTTTTTCCTCTTTTTTCTCCTTTCTCTTTTTGTGCCATCTTGGCGCTCCACCTGGGGCCCTCATCTCCACAGGCTTCACCGAGCCCTTTTCTGTCAACCCAAGGTACCAAAGGCCTTCCCCCAAACCTTA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTCCTTCCTGCGCTTCT