ORFeome > snx2 ORF1 – XORFeome v1.0

snx2 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: snx2
Gene ID: 5791539
Gene Page ID: 5791487
ORF Xenbase ID: 17298081

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054996
Original XGC clone length: 1560

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11003
Well Location: B05

Sequences - 5ʹ (forward) EST

Accession: JZ839437
dbEST ID: 79657139
Trimmed Sequence: ATGGCAGCAGAGAGAGAGCCTCCTCCTCTTGGGGATGGGGGACAGGCTGAGTGTGAGGATCTGGAGGAAGGGGAAGACTTGTTCGCCAGTACCGTGTCTACACTGGAGTCAAGCCCATCATCCCCAGAACCAGCCAGTCTTCCTGCTGAAGACATCAGTACAAATTCTAATGGCCCCAAGACTACAGAAGTTCTACTTTGTGATGACCGAGAAGATCTTTTTGCTGAAGCTACTGATGAAGTTTCCTTGGATAGCCCTGAAAGAGATCTCATCCTTTCATCAGAACCTAGTCCAGCCATAACACCTGTGACACCAACATCACTTATAACGCCGCGAATGGAAACTATTAGTATATCTGCACCTGTGATTTATGACCGATCAACAGATGAGATTGAAGAGGAAGCAAATGGGGATGCCTTTGATTTGGAAATTGGTGTCTCAGACCCAGAAAAAGTTGGGGATGGAATGAATGCTTACATGGCATACAGAGTTACTACCAAGACTTCTTTGTCAATGTTCAACAAGAACGAGTTCTTTGTCCGTAGAAGATTCAGTGATTTTCTTGGGCTGCATAGTAGACTAGCAACAAAATATATGCATATTGNNGTATATTGTGCCACCAGCTCCTGAGAAAAGTATAGTAAGCATGACGAAAGTAAAGGTGGGAAAAGAGGATTCGTCATNCAACGAGTTTGTTGGAGAAGAGAGGGGCTGCTCTGGGAAGATATCTACAGCGCACAGTCAAACACCCTACTCTCCTGCAGGATTCCAATTTTAGGCAAATTCCAAAAAAGTTCTAGAAGCGTGCCAAAACGGTTGGAACCCCCAGGC
Full Trace Sequence: CGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCAGCAGAGAGAGAGCCTCCTCCTCTTGGGGATGGGGGACAGGCTGAGTGTGAGGATCTGGAGGAAGGGGAAGACTTGTTCGCCAGTACCGTGTCTACACTGGAGTCAAGCCCATCATCCCCAGAACCAGCCAGTCTTCCTGCTGAAGACATCAGTACAAATTCTAATGGCCCCAAGACTACAGAAGTTCTACTTTGTGATGACCGAGAAGATCTTTTTGCTGAAGCTACTGATGAAGTTTCCTTGGATAGCCCTGAAAGAGATCTCATCCTTTCATCAGAACCTAGTCCAGCCATAACACCTGTGACACCAACATCACTTATAACGCCGCGAATGGAAACTATTAGTATATCTGCACCTGTGATTTATGACCGATCAACAGATGAGATTGAAGAGGAAGCAAATGGGGATGCCTTTGATTTGGAAATTGGTGTCTCAGACCCAGAAAAAGTTGGGGATGGAATGAATGCTTACATGGCATACAGAGTTACTACCAAGACTTCTTTGTCAATGTTCAACAAGAACGAGTTCTTTGTCCGTAGAAGATTCAGTGATTTTCTTGGGCTGCATAGTAGACTAGCAACAAAATATATGCATATTGNNGTATATTGTGCCACCAGCTCCTGAGAAAAGTATAGTAAGCATGACGAAAGTAAAGGTGGGAAAAGAGGATTCGTCATNCAACGAGTTTGTTGGAGAAGAGAGGGGCTGCTCTGGGAAGATATCTACAGCGCACAGTCAAACACCCTACTCTCCTGCAGGATTCCAATTTTAGGCAAATTCCAAAAAAGTTCTAGAAGCGTGCCAAAACGGTTGGAACCCCCAGGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAGCAGAGAGAGAG

Sequences - 3ʹ (reverse) EST

Accession: JZ839436
dbEST ID: 79657138
Trimmed Sequence: TGCTATGGCTTTGGCTTCGGGTAGAAAAGCTTCCCAATACTTTATGAGCTGTTGTTGTGTTCGCACTAATGATTCTAAGTACTTTATAATAATGTTTTTGAAGTCTCTCACCCTCTCTTTCTCAAATCTTCCTAATTCCTTGCGAATAGTTTTGGATATTTGGTCAAAATCTCTCTCTCCTTGTTGAACCTTGGCCTCCCACTCTCTGATTTCATCTTTAGCCTGCTGAAGTTTATCAGGTTTATTGGAGATCTGAAGTTTGGCCTCTGCCTCCTGTTTTTTTTGCAGATTGACCTGAGCGTCCTGCCATTTTTGCCAGCACTTTACTCTCTGATCAAATACACCCTTGACAGCAGCAATAAGTCGTATATAGTCACTTAGGAGTTCGGAAAACAAATAGAAGTCTGCGAAGGCCTGATCTTGATGCAGCTGGTCAATTTTTCCTTCCACCTCTGCAAGCTGGGATAATGCCCGGGAGAGTGCAGTGTGATCTTCTGAATTGCCCAACATTGCAGCACTCTTTGCAAATGCAGCTGTGTTGGCTGACAGCTCTTTGCGATGACGAACCAAGGATTCAACATTGCCATGTAGCTTCCTGAGTTGCTGATCTAGATTTTCAAACTGCTGCTGTTTTTCTTCCAACCAAGCATCCGATTCATTCATCTTGAATGTCATTTTGTTGACCCCTTCTTGCCGCTTTGGTCCCCATTCCTCATAAATCCTGCTTCCGCTCCAAACCCGGGGGTGCCAACTTGGCTCTGGGGCCACCTCCAAAAACTT
Full Trace Sequence: AAAACTGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGCTATGGCTTTGGCTTCGGGTAGAAAAGCTTCCCAATACTTTATGAGCTGTTGTTGTGTTCGCACTAATGATTCTAAGTACTTTATAATAATGTTTTTGAAGTCTCTCACCCTCTCTTTCTCAAATCTTCCTAATTCCTTGCGAATAGTTTTGGATATTTGGTCAAAATCTCTCTCTCCTTGTTGAACCTTGGCCTCCCACTCTCTGATTTCATCTTTAGCCTGCTGAAGTTTATCAGGTTTATTGGAGATCTGAAGTTTGGCCTCTGCCTCCTGTTTTTTTTGCAGATTGACCTGAGCGTCCTGCCATTTTTGCCAGCACTTTACTCTCTGATCAAATACACCCTTGACAGCAGCAATAAGTCGTATATAGTCACTTAGGAGTTCGGAAAACAAATAGAAGTCTGCGAAGGCCTGATCTTGATGCAGCTGGTCAATTTTTCCTTCCACCTCTGCAAGCTGGGATAATGCCCGGGAGAGTGCAGTGTGATCTTCTGAATTGCCCAACATTGCAGCACTCTTTGCAAATGCAGCTGTGTTGGCTGACAGCTCTTTGCGATGACGAACCAAGGATTCAACATTGCCATGTAGCTTCCTGAGTTGCTGATCTAGATTTTCAAACTGCTGCTGTTTTTCTTCCAACCAAGCATCCGATTCATTCATCTTGAATGTCATTTTGTTGACCCCTTCTTGCCGCTTTGGTCCCCATTCCTCATAAATCCTGCTTCCGCTCCAAACCCGGGGGTGCCAACTTGGCTCTGGGGCCACCTCCAAAAACTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGCTATGGCTTTGGCTTCGGGT