ORFeome > snx30 ORF1 – XORFeome v1.0

snx30 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: snx30
Gene ID: 944722
Gene Page ID: 944716
ORF Xenbase ID: 17298105

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC097784
Original XGC clone length: 1359

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11089
Well Location: G10

Sequences - 5ʹ (forward) EST

Accession: JZ838358
dbEST ID: 79656060
Trimmed Sequence: ATGTCAGGCTCCAGTTCTCCTAAATGTACTCCCAAATCTTTACCTACTTCTGGGCAGAAGTCTCTACATGACATCAAGCACCCTCTGAGCTGTTCCCCTGGGGCAGAGGATGATGCAGCAGCAGCAGGTGAAAATGGAGCAGTTATTATTGATTCTCCAAGCCCGGATCTACCCCATACTGAGCCCAGCAGCATAGCAGATAAGGACCTGAGTTTGCCCAATGGTACTCCAGCAGACACATCCAGCCCAGCATCCTCATCGTCACTTCTCAACAGACTGCAGTTGGATGATGACTTGGATGGTGAGACAAGGGACCTTTTTGTTACAGTTGATGACCCAAAGAAACACGTGTGCACTATGGAAACCTACATAACCTACAGTGTGTCAACAAAGACTACGCGGACAGAATTTGATCTGCCAGAGTATTCTGTACGCCGACGGTACCAAGACTTTGATTGGCTAAGGAATAAACTTGAAGAAACCCAACCCACCCACTTCATTCCCCCACTTCCTGAGAAATTTGTGGTGAAAGGAGTTGTTGACCGCTTTTCTGAAGAGTTTGTGGAGACCAGGAGAAAAGCTTTGGACAAATTTCTTAAAAGGATTGCGGATCATCCAATCTTGTCCTTTAATGAACATTTTAATGTGTTTCTAACAGCCCAGGGACCTGAACAACCACAAAAAACAGG
Full Trace Sequence: AAAGCCCCANTCTACTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCAGGCTCCAGTTCTCCTAAATGTACTCCCAAATCTTTACCTACTTCTGGGCAGAAGTCTCTACATGACATCAAGCACCCTCTGAGCTGTTCCCCTGGGGCAGAGGATGATGCAGCAGCAGCAGGTGAAAATGGAGCAGTTATTATTGATTCTCCAAGCCCGGATCTACCCCATACTGAGCCCAGCAGCATAGCAGATAAGGACCTGAGTTTGCCCAATGGTACTCCAGCAGACACATCCAGCCCAGCATCCTCATCGTCACTTCTCAACAGACTGCAGTTGGATGATGACTTGGATGGTGAGACAAGGGACCTTTTTGTTACAGTTGATGACCCAAAGAAACACGTGTGCACTATGGAAACCTACATAACCTACAGTGTGTCAACAAAGACTACGCGGACAGAATTTGATCTGCCAGAGTATTCTGTACGCCGACGGTACCAAGACTTTGATTGGCTAAGGAATAAACTTGAAGAAACCCAACCCACCCACTTCATTCCCCCACTTCCTGAGAAATTTGTGGTGAAAGGAGTTGTTGACCGCTTTTCTGAAGAGTTTGTGGAGACCAGGAGAAAAGCTTTGGACAAATTTCTTAAAAGGATTGCGGATCATCCAATCTTGTCCTTTAATGAACATTTTAATGTGTTTCTAACAGCCCAGGGACCTGAACAACCACAAAAAACAGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCAGGCTCCAGTTCTC

Sequences - 3ʹ (reverse) EST

Accession: JZ838357
dbEST ID: 79656059
Trimmed Sequence: CTTTGGTTCCTGTTTGTCTTGTAGCAGTGGTATAATGGACTCCCAGGCTGTAAGGCACTTTTCATAGTACTGGATGTTTTTGTCAGCCACTCCCATAAGCAGCTGCCGGAAGTCTTGCCTCTTGTTATTCTGCCACCGGTCCATGTCCGCTTTCAGATCTGCATTAAAACATTCTACCTTATCCTGGCACTTCTCTACATCCGTTGGCACCGTAGATCGCTCTTCTCTTTTCAAGGCAGCAGCCTCTGATTTGGCCTCATACTCTGCTTGTACTTGATCCCTTTTCTTTAAAACTGTCTTCATAGATTCAGAGTATAGAATATATTCTCTGATCACAGGCATAAAGTCCTCTGACATGTCTTCTGTTAGCTCTTCCAGTGCCGTGCAGCAGTTTCCAACACAGGCTGACACTCCCTCCAGAGGCTCATTTAACTCCTTTTCCAACCCACTCCACGTGGAGTATACAGGTCCATACTCTCGAAGCTCCATTAAGTATTCCACTTCCTCTTTGATAATGCGTTGTGCTATTCTGTCAATTGTGCCAAGCTTCAGTGCAAATGTGTCCCAGTAATCTGTTACGGTGGCAAATTCCGCAGGACGGTTCCGGAATTTGTAACCACTTGTCACATATCGCAAAGACTCTCCCATTTTTTAAAAGCAAAAAAACACCC
Full Trace Sequence: ACGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTTTGGTTCCTGTTTGTCTTGTAGCAGTGGTATAATGGACTCCCAGGCTGTAAGGCACTTTTCATAGTACTGGATGTTTTTGTCAGCCACTCCCATAAGCAGCTGCCGGAAGTCTTGCCTCTTGTTATTCTGCCACCGGTCCATGTCCGCTTTCAGATCTGCATTAAAACATTCTACCTTATCCTGGCACTTCTCTACATCCGTTGGCACCGTAGATCGCTCTTCTCTTTTCAAGGCAGCAGCCTCTGATTTGGCCTCATACTCTGCTTGTACTTGATCCCTTTTCTTTAAAACTGTCTTCATAGATTCAGAGTATAGAATATATTCTCTGATCACAGGCATAAAGTCCTCTGACATGTCTTCTGTTAGCTCTTCCAGTGCCGTGCAGCAGTTTCCAACACAGGCTGACACTCCCTCCAGAGGCTCATTTAACTCCTTTTCCAACCCACTCCACGTGGAGTATACAGGTCCATACTCTCGAAGCTCCATTAAGTATTCCACTTCCTCTTTGATAATGCGTTGTGCTATTCTGTCAATTGTGCCAAGCTTCAGTGCAAATGTGTCCCAGTAATCTGTTACGGTGGCAAATTCCGCAGGACGGTTCCGGAATTTGTAACCACTTGTCACATATCGCAAAGACTCTCCCATTTTTTAAAAGCAAAAAAACACCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTTGGTTCCTGTTTGTCTTGT