ORFeome > snx31 ORF2 – XORFeome v1.0

snx31 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: snx31
Gene ID: 5933804
Gene Page ID: 5933723
ORF Xenbase ID: 17298117

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC106667
Original XGC clone length: 1296

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11082
Well Location: F10

Sequences - 5ʹ (forward) EST

Accession: JZ837261
dbEST ID: 79654963
Trimmed Sequence: ATGCATATCTGCATCCCTGTCACAGAGGAGCTCCAGGACACCCTTGGGTGCCGCTTTGTGCTCTATTCTGTGTACCTGGAAGGTTTCCTCCTGTTTAAAGTACGATACAAAGACCTGCACCTATGGAATGAACAGATTCATCGAGTGTTTGGAAATGGACTGCCAAAATTCCCACCGAAACATTATTTAGCTATGACCAAGAATATGGCTAATGAAAGAAGACTGCAGCTCGAGCAGTATCTACAACAAATTGTTACAGATCCAGTGGTTACCAGCAGTGACATTTTCATGGATTATTTCAGGAAATTACAAATGGACACATTTAATATGCCCACAGTAAAGCTTATCCTACGAGTATACGTGCCAGATGGAGCAGCAGTTGAATTAGATGTTCGGACTTCAGACAGTGCTGAGAGAGTGCTTGAGGCTGCATTGTTCAGATTAGGTGTCTCAAGAGAGCTGGCCGAATATTTCAGCTTATTTATCACACACAAAGAAGCAAAGGGCCCTTTTACAGTCGTAAAACGAATTGCAGCATTTGAACTTCCCTTCCTAACAATATGGAACCTAGAGGATGATCAGTTCCAGATTGAAGTCAGAAAGTGGTATATGAACCCCTCAAATGATGTTATGCTAATGGGCAGTACTGAAGCTATTGATATACTTTACCTGCAGGCTGTGCCAAGAGTTTCAGATGGACTGGACCCAGGCGAACAAAGACCAAGAAACAGAAACTGCAACACTGTTTTAAAAGAAGAAAAAAAAAATAAAATTTTTTTGAAACTTTATTAAAAAAAGGGTGGAAAAATTAAGGGGAAAA
Full Trace Sequence: GGCGGGCCATATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCATATCTGCATCCCTGTCACAGAGGAGCTCCAGGACACCCTTGGGTGCCGCTTTGTGCTCTATTCTGTGTACCTGGAAGGTTTCCTCCTGTTTAAAGTACGATACAAAGACCTGCACCTATGGAATGAACAGATTCATCGAGTGTTTGGAAATGGACTGCCAAAATTCCCACCGAAACATTATTTAGCTATGACCAAGAATATGGCTAATGAAAGAAGACTGCAGCTCGAGCAGTATCTACAACAAATTGTTACAGATCCAGTGGTTACCAGCAGTGACATTTTCATGGATTATTTCAGGAAATTACAAATGGACACATTTAATATGCCCACAGTAAAGCTTATCCTACGAGTATACGTGCCAGATGGAGCAGCAGTTGAATTAGATGTTCGGACTTCAGACAGTGCTGAGAGAGTGCTTGAGGCTGCATTGTTCAGATTAGGTGTCTCAAGAGAGCTGGCCGAATATTTCAGCTTATTTATCACACACAAAGAAGCAAAGGGCCCTTTTACAGTCGTAAAACGAATTGCAGCATTTGAACTTCCCTTCCTAACAATATGGAACCTAGAGGATGATCAGTTCCAGATTGAAGTCAGAAAGTGGTATATGAACCCCTCAAATGATGTTATGCTAATGGGCAGTACTGAAGCTATTGATATACTTTACCTGCAGGCTGTGCCAAGAGTTTCAGATGGACTGGACCCAGGCGAACAAAGACCAAGAAACAGAAACTGCAACACTGTTTTAAAAGAAGAAAAAAAAAATAAAATTTTTTTGAAACTTTATTAAAAAAAGGGTGGAAAAATTAAGGGGAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCATATCTGCATCCCTGT

Sequences - 3ʹ (reverse) EST

Accession: JZ837260
dbEST ID: 79654962
Trimmed Sequence: CAGATTCAGATCAGAAATATCATCTATCAGACAATATTCTGCCTTGTCCTTTAATAATGTCTGCTTTTTAGTATGCACTCCATTCTGTACAGGCCTTATGTTAAACTTGTATGTTGCTTGTGCTCGGTCGACCTGAATTTCCAGCTCCTCCTTGGATCGATGGACAGGGTACTCAGATAACATCTTTTTTAAGCAACTGCTAAGTAGGAAGGCCTGTTCCGTACGTATGGTGATGCATTTCAATGAAGACCCCTGCTGGTATTCAAACTTGAACTCCAAGTGCTGGTGATTGGGAGACATGACTTCTTGCTTCTTGGGCTGAAGTAGGCTGACATTCCAGCAAATTAGATCCCTGATGTTTAATCTTAAATGTTCAGTATGGCCACCGGGAGAGTGAAAGTGGCAACTCATTTCATTATTCCCCACCCATACGTTGACTTCAGAATCACATTCTGGGTAGTCACTGGCACAAGAGGCAATTTGTAAATATCCATAATATTCCACCCTCTTCATTAACTCCAAAAACATTAGTTTGTTTTCTTCTTTTTAACAATGCTGCGGTTGCTGTTTCTGGTCCTTGTTGGGCCTGGGCGGGTCCGTCGTGAACTCTTTGACCACCCTGCGGGTACGGGAGGTCAGTAAGTTCATTACTGGCCCTTTGCAGTGACATCATTTTAAAGGGTTCCAAGTCGGGTTTTCTGACTTCGATCTAGAAAACTGAATATTG
Full Trace Sequence: AAAACTGCTATTGACGCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACAGATTCAGATCAGAAATATCATCTATCAGACAATATTCTGCCTTGTCCTTTAATAATGTCTGCTTTTTAGTATGCACTCCATTCTGTACAGGCCTTATGTTAAACTTGTATGTTGCTTGTGCTCGGTCGACCTGAATTTCCAGCTCCTCCTTGGATCGATGGACAGGGTACTCAGATAACATCTTTTTTAAGCAACTGCTAAGTAGGAAGGCCTGTTCCGTACGTATGGTGATGCATTTCAATGAAGACCCCTGCTGGTATTCAAACTTGAACTCCAAGTGCTGGTGATTGGGAGACATGACTTCTTGCTTCTTGGGCTGAAGTAGGCTGACATTCCAGCAAATTAGATCCCTGATGTTTAATCTTAAATGTTCAGTATGGCCACCGGGAGAGTGAAAGTGGCAACTCATTTCATTATTCCCCACCCATACGTTGACTTCAGAATCACATTCTGGGTAGTCACTGGCACAAGAGGCAATTTGTAAATATCCATAATATTCCACCCTCTTCATTAACTCCAAAAACATTAGTTTGTTTTCTTCTTTTTAACAATGCTGCGGTTGCTGTTTCTGGTCCTTGTTGGGCCTGGGCGGGTCCGTCGTGAACTCTTTGACCACCCTGCGGGTACGGGAGGTCAGTAAGTTCATTACTGGCCCTTTGCAGTGACATCATTTTAAAGGGTTCCAAGTCGGGTTTTCTGACTTCGATCTAGAAAACTGAATATTG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAGATTCAGATCAGAAATATCATC